Caspase-6 (CASP6) (NM_032992) Human 3' UTR Clone

CAT#: SC209070

3`UTR clone of caspase 6 apoptosis-related cysteine peptidase (CASP6) transcript variant beta for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP6
• Synonyms: MCH2
• ACCN: NM_032992
• Insert Size: 726 bp
• Sequence Data:
  Insert Sequence

  >SC209070 3'UTR clone of NM_032992
  The sequence shown below is from the reference sequence of NM_032992. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAATGCTAACTAAAAAGCTGCATTTCTTTCCAAAATCTAATTAATTAATAGAGGCTATCTAATTTTACAC
  TCTGTATTGAAAATGGCTTTCTCAGCCAGGCGTGGTTACTCACACCTGTAATCCCAGCACTTTGGGAGTC
  CAAGGTGGGCGGATCACCTGAGGTCGGGAGTTCGAGACCAGCCTGACCAACATGGAGAAGCCCCGTCTCT
  ACTAAAAATGCAAAAAAAAATTTAGCTAGGCATGGCGGCGCATGCCTGCAATCCCAGCTACTTGGAAGGC
  TGAGGCAGGAGAATCACTTGAACCCAGGAGGTGGAGGCTGCGGTGAGCCGAGATTGCGCCATTGCACTCC
  AGCCTGGGCAACGAGTGAAACTCCGTCTCAAAAAAAAGAAAATGTCTTTCTCTTCCTTTTATATAAATAT
  CGTTAGGGTGAAGCATTATGGTCTAATGATTCAAATGTTTTAAAGTTTAATGCCTAGCAGAGAACTGCCT
  TAAAAAAAAAAAAAAAAAGTTCATGTTGGCCATGGTGAAAGGGTTTGATATGGAGAAACAAAATCCTCAG
  GAAATTAGATAAATAAAAATTTATAAGCATTTGTATTATTTTTTAATAAACTGCAGGGTTACACAAAAAT
  CTAGCTGATTTAACTTGTATTTTGTCACTTTTTTATAAAAGTTTATTGTTTGATGTTTTTAAAGGTTTTT
  GAAATCCAGGAATTAAATCATCCCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_032992.2
• Summary: 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family of enzymes. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic acid residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein is processed by caspases 7, 8 and 10, and is thought to function as a downstream enzyme in the caspase activation cascade. Alternative splicing of this gene results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Oct 2015]'
• Locus ID: 839