ALOX15 (NM_001140) Human 3' UTR Clone

CAT#: SC209098

3`UTR clone of arachidonate 15-lipoxygenase (ALOX15) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALOX15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ALOX15
Synonyms 12-LOX; 15-LOX; 15-LOX-1; LOG15
ACCN NM_001140
Insert Size 680 bp
Sequence Data
>SC209098 3'UTR clone of NM_001140
The sequence shown below is from the reference sequence of NM_001140. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGGTGGAAAACAGTGTGGCCATCTAAGCGTCGCCACCCTTTGGTTATTTCAGCCCCCATCACCCAAGCC
ACAAGCTGACCCCTTCGTGGTTATAGCCCTGCCCTCCCAAGTCCCACCCTCTTCCCATGTCCCACCCTCC
CTAGAGGGGCACCTTTTCATGGTCTCTGCACCCAGTGAACACATTTTACTCTAGAGGCATCACCTGGGAC
CTTACTCCTCTTTCCTTCCTTCCTCCTTTCCTATCTTCCTTCCTCTCTCTCTTCCTCTTTCTTCATTCAG
ATCTATATGGCAAATAGCCACAATTATATAAATCATTTCAAGACTAGAATAGGGGGATATAATACATATT
ACTCCACACCTTTTATGAATCAAATATGATTTTTTTGTTGTTGTTAAGACAGAGTCTCACTTTGACACCC
AGGCTGGAGTGCAGTGGTGCCATCACCACGGCTCACTGCAGCCTCAGCGTCCTGGGCTCAAATGATCCTC
CCACCTCAGCCTCCTGAGTAGCTGGGACTACAGGCTCATGCCATCATGCCCAGCTAATATTTTTTTATTT
TCGTGGAGACGGGGCCTCACTATGTTGCCTAGGCTGGAAATAGGATTTTGAACCCAAATTGAGTTTAACA
ATAATAAAAAGTTGTTTTACGCTAAAGATGGAAAAGAACTAGGACTGAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001140.3
Summary 'This gene encodes a member of the lipoxygenase family of proteins. The encoded enzyme acts on various polyunsaturated fatty acid substrates to generate various bioactive lipid mediators such as eicosanoids, hepoxilins, lipoxins, and other molecules. The encoded enzyme and its reaction products have been shown to regulate inflammation and immunity. Multiple pseudogenes of this gene have been identified in the human genome. [provided by RefSeq, Aug 2017]'
Locus ID 246

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.