CD40 (NM_001250) Human 3' UTR Clone

CAT#: SC209107

3`UTR clone of CD40 molecule TNF receptor superfamily member 5 (CD40) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD40"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CD40
Synonyms Bp50; CDW40; p50; TNFRSF5
ACCN NM_001250
Insert Size 707 bp
Sequence Data
>SC209107 3'UTR clone of NM_001250
The sequence shown below is from the reference sequence of NM_001250. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAAC
AGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTGAGGGGCTGGCACTGACTGGG
CATAGCTCCCCGCTTCTGCCTGCACCCCTGCAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAG
TTCACCTTGAAGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTTGTATTAAAGACAGAGG
CAGAAGTTTGGTGGTGGTGGTGTTGGGGTATGGTTTAGTAATATCCACCAGACCTTCCGATCCAGCAGTT
TGGTGCCCAGAGAGGCATCATGGTGGCTTCCCTGCGCCCAGGAAGCCATATACACAGATGCCCATTGCAG
CATTGTTTGTGATAGTGAACAACTGGAAGCTGCTTAACTGTCCATCAGCAGGAGACTGGCTAAATAAAAT
TAGAATATATTTATACAACAGAATCTCAAAAACACTGTTGAGTAAGGAAAAAAAGGCATGCTGCTGAATG
ATGGGTATGGAACTTTTTAAAAAAGTACATGCTTTTATGTATGTATATTGCCTATGGATATATGTATAAA
TACAATATGCATCATATATTGATATAACAAGGGTTCTGGAAGGGTACACAGAAAACCCACAGCTCGAAGA
GTGGTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001250.4
Summary 'This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]'
Locus ID 958

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.