PTP4A2 (NM_080392) Human 3' UTR Clone

CAT#: SC209160

3`UTR clone of protein tyrosine phosphatase type IVA member 2 (PTP4A2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTP4A2
• Synonyms: HH7-2; HH13; HU-PP-1; OV-1; PRL-2; PRL2; ptp-IV1a; ptp-IV1b; PTP4A; PTPCAAX2
• ACCN: NM_080392
• Insert Size: 739
• Sequence Data:
  Insert Sequence

  >SC209160 3'UTR clone of NM_080392
  The sequence shown below is from the reference sequence of NM_080392. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCGTTCAATTCCAAACAGCTGCTTTATTTGGAGAAATACCGACCTAAGATGCGATTACGCTTCAGAGATA
  CCAATGGGCATTGCTGTGTTCAGTAGAAGGAAATGTAAACGAAGGCTGACTTGATTGTGCCATTTAGAGG
  GAACTCTTGGTACCTGGAAATGTGAATCTGGAATATTACCTGTGTCATCAAAGTAGTGATGGATTCAGTA
  CTCCTCAACCACTCTCCTAATGATTGGAACAAAAGCAAACAAAAAAGAAATCTCTCTATAAAATGAATAA
  AATGTTTAAGAAAAGAGAAAGAGAAAAGGAATTAATTCAGTGAAGGATGATTTTGCTCCTAGTTTTGGAG
  TTTGAATTTCTGCCAGGATTGAATTATTTTGAAATCTCCTGTCTTTTTAAACTTTTTCAAAATAGGTCTC
  TAAGGAAAACCAGCAGAACATTAGCCTGTGCAAAACCATCTGTTTGGGGAGCACACTCTTCCATTATGCT
  TGGCACATAGATCTCCCTGTGGTGGGATTTTTTTTTTCCCTTTTTTTGTGGGGGAGGGTTGGTGGTATAT
  TTTTCCCCTCTTTTTTCCTTCCTCTCCTACATCTCCCTTTTCCCCCGATCCAAGTTGTAGATGGAATAGA
  AGCCCTTGTTGCTGTAGATGTGCGTGCAGTCTGGCAGCCTTAAGCCCACCTGGGCACTTTTAGATAAAAA
  AAAAAAAAAAACAAAAAACAACACCAAAAAAACAGCAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_080392.2
• Summary: The protein encoded by this gene belongs to a small class of the protein tyrosine phosphatase (PTP) family. PTPs are cell signaling molecules that play regulatory roles in a variety of cellular processes. PTPs in this class contain a protein tyrosine phosphatase catalytic domain and a characteristic C-terminal prenylation motif. This PTP has been shown to primarily associate with plasmic and endosomal membrane through its C-terminal prenylation. This PTP was found to interact with the beta-subunit of Rab geranylgeranyltransferase II (beta GGT II), and thus may function as a regulator of GGT II activity. Overexpression of this gene in mammalian cells conferred a transformed phenotype, which suggested its role in tumorigenesis. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 11, 12 and 17. [provided by RefSeq, Aug 2010]
• Locus ID: 8073