p57 Kip2 (CDKN1C) (NM_001122631) Human 3' UTR Clone

CAT#: SC209170

3`UTR clone of cyclin-dependent kinase inhibitor 1C (p57 Kip2) (CDKN1C) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDKN1C
• Synonyms: BWCR; BWS; KIP2; p57; p57Kip2; WBS
• ACCN: NM_001122631
• Insert Size: 700 bp
• Sequence Data:
  Insert Sequence

  >SC209170 3'UTR clone of NM_001122631
  The sequence shown below is from the reference sequence of NM_001122631. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAGAGGCTGCGGTGAGCCAAAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTTGGAAG
  GGCGCTGGGCCTCGGCTGGGACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCGTTCGG
  TTTTGTTTTTAAATTTTGAAAACTGTGCAATGTATTAATAACGTCTTTTTATATCTAAATGTATTCTGCA
  CGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGAGTCATTTATATAAAATGTTTAATCTCTGCTG
  AAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAAAAAACCATGTATATTTGTACA
  AAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCTCTGCCACGCAC
  TAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTAACTTT
  ATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCTAGCTT
  GCAGTCTCTTCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAAGTCTG
  TTAAAATGGTTCCTGAGCCGTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAAGAGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001122631.1
• Summary: 'This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]'
• Locus ID: 1028