Axin 1 (AXIN1) (NM_181050) Human 3' UTR Clone

CAT#: SC209178

3`UTR clone of axin 1 (AXIN1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AXIN1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AXIN1
Synonyms AXIN; PPP1R49
ACCN NM_181050
Insert Size 684
Sequence Data
>SC209178 3'UTR clone of NM_181050
The sequence shown below is from the reference sequence of NM_181050. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATCGGCAAAGTGGAGAAGGTGGACTGATAGGCTGGTGGGCTGGCCGCTGTGCCAGGCGAGGCCCTTGGC
GGGCACGGGTGTCACGGCCAGGCAGATGACCTCGTACTCAGGAGCCCGATGGGGAACAGTGTTGGGTGTA
CCACCCATCCCTGTGGTCTACCCGTGTCTAGAGGCAGGTAGGGGGTCCCTCCAAGTGGTCCACAAGCTTC
TGTCCTGCCCCCAAGGAGGCAGCCTGGACCACTCCTCATAGCAATACTTGGAGGGCCCAGCCCAAGTGAG
GCAGCCGAGGTCCCTGCTGCCAGCTTCAGGTGACCCCCCCCCATCCCCCGGCACCTCCCTTGGGCACGTG
TGCTGGGATCTACTTTCCCTCTGGGATTTGCCCACGTACCCAGGTCTGGGTGGGGCCCAGGCCCGGATGC
AGAGGCCTGCAGGGCCTCTGTCAATTGTACGCGCCACCGAGTGCCTTCAACACAGCTTGTCTCTTGCCTG
CCACTGTGTGAATCGGCGACGGAGCACTGCACCTGCCTCCAGCCGCCGGCTGTGCAGTCCTGGGTCCTCC
TTTCTGAGGGCCCGTGTAAATATGTACATTTCTCAGGCTAGGCCAGCAGGGGCTGCCCGAGTCTGTTTTT
CATGCGATGACACTTGTACAATTAATTATCTTTTCAAAGGTACTTGGATAATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181050.1
Summary This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 8312

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.