p57 Kip2 (CDKN1C) (NM_000076) Human 3' UTR Clone

CAT#: SC209217

3`UTR clone of cyclin-dependent kinase inhibitor 1C (p57 Kip2) (CDKN1C) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDKN1C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CDKN1C
Synonyms BWCR; BWS; KIP2; p57; p57Kip2; WBS
ACCN NM_000076
Insert Size 705 bp
Sequence Data
>SC209217 3'UTR clone of NM_000076
The sequence shown below is from the reference sequence of NM_000076. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAAGAGGCTGCGGTGAGCCAATTTAGAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTT
GGAAGGGCGCTGGGCCTCGGCTGGGACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCG
TTCGGTTTTGTTTTTAAATTTTGAAAACTGTGCAATGTATTAATAACGTCTTTTTATATCTAAATGTATT
CTGCACGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGAGTCATTTATATAAAATGTTTAATCTC
TGCTGAAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAAAAAACCATGTATATTT
GTACAAAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCTCTGCCA
CGCACTAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTA
ACTTTATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCT
AGCTTGCAGTCTCTTCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAA
GTCTGTTAAAATGGTTCCTGAGCCGTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAA
GAGGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000076.2
Summary 'This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]'
Locus ID 1028

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.