Niemann Pick C1 (NPC1) (NM_000271) Human 3' UTR Clone

CAT#: SC209222

3`UTR clone of Niemann-Pick disease type C1 (NPC1) for miRNA target validation

Reconstitution Protocol

USD 560.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NPC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NPC1
Synonyms NPC; POGZ; SLC65A1
ACCN NM_000271
Insert Size 717 bp
Sequence Data
>SC209222 3'UTR clone of NM_000271
The sequence shown below is from the reference sequence of NM_000271. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCGATACAAAGGAACAGAGCGCGAACGGCTTCTAAATTTCTAGCCCTCTCGCAGGGCATCCTGACTGAAC
TGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGCCAAGTTGAACACCGGAT
GGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCACAGTTGA
CTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAA
AGAAACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACT
CTGTAAAGGCCAATCAATGCACTGTCTGTCTCTCCTTTTAGGAGTAAGCCATCCCACAAGTTCTATACCA
TATTTTTAGTGACAGTTGAGGTTGTAGATACACTTTATAACATTTTATAGTTTAAAGAGCTTTATTAATG
CAATAAATTAACTTTGTACACATTTTTATATAAAAAAACAGCAAGTGATTTCAGAATGTTGTAGGCCTCA
TTAGAGCTTGGTCTCCAAAAATCTGTTTGAAAAAAGCAACATGTTCTTCACAGTGTTCCCCTAGAAAGGA
AGAGATTTAATTGCCAGTTAGATGTGGCATGAAATGAGGGACAAAGAAAGCATCTCGTAGGTGTGTCTAC
TGGGTTTTAACTTATTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000271.4
Summary 'This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]'
Locus ID 4864

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.