hnRNP A1 (HNRNPA1) (NM_002136) Human 3' UTR Clone

CAT#: SC209239

3`UTR clone of heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HNRNPA1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HNRNPA1
Synonyms ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1
ACCN NM_002136
Insert Size 697 bp
Sequence Data
>SC209239 3'UTR clone of NM_002136
The sequence shown below is from the reference sequence of NM_002136. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTATGGCAGTGGCAGAAGATTTTAATTAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACA
GGGAAGCTACAGGTTACAACAGATTTGTGAACTCAGCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACA
AAGAAGACATGTTTTAGACAAATACTCATGTGTATGGGCAAAAAACTCGAGGACTGTATTTGTGACTAAT
TGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACAAAGGGTTTTAATGTA
GATTTTTTTTTTTGCACCCCATGCTGTTGATTGCTAAATGTAACAGTCTGATCGTGACGCTGAATAAATG
TCTTTTTTTTAATGTGCTGTGTAAAGTTAGTCTACTCTTAAGCCATCTTGGTAAATTTCCCCAACAGTGT
GAAGTTAGAATTCCTTCAGGGTGATGCCAGGTTCTATTTGGAATTTATATACAACCTGCTTGGGTGGAGA
AGCCATTGTCTTCGGAAACCTTGGTGTAGTTGAACTGATAGTTACTGTTGTGACCTGAAGTTCACCATTA
AAAGGGATTACCCAAGCAAAATCATGGAATGGTTATAAAAGTGATTGTTGGCACATCCTATGCAATATAT
CTAAATTGAATAATGGTACCAGATAAAATTATAGATGGGAATGAAGCTTGTGTATCCATTATCATGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002136.2
Summary 'This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016]'
Locus ID 3178

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.