hnRNP A1 (HNRNPA1) (NM_031157) Human 3' UTR Clone

CAT#: SC209240

3`UTR clone of heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HNRNPA1
• Synonyms: ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1
• ACCN: NM_031157
• Insert Size: 697 bp
• Sequence Data:
  Insert Sequence

  >SC209240 3'UTR clone of NM_031157
  The sequence shown below is from the reference sequence of NM_031157. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTATGGCAGTGGCAGAAGATTTTAATTAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACA
  GGGAAGCTACAGGTTACAACAGATTTGTGAACTCAGCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACA
  AAGAAGACATGTTTTAGACAAATACTCATGTGTATGGGCAAAAAACTCGAGGACTGTATTTGTGACTAAT
  TGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACAAAGGGTTTTAATGTA
  GATTTTTTTTTTTGCACCCCATGCTGTTGATTGCTAAATGTAACAGTCTGATCGTGACGCTGAATAAATG
  TCTTTTTTTTAATGTGCTGTGTAAAGTTAGTCTACTCTTAAGCCATCTTGGTAAATTTCCCCAACAGTGT
  GAAGTTAGAATTCCTTCAGGGTGATGCCAGGTTCTATTTGGAATTTATATACAACCTGCTTGGGTGGAGA
  AGCCATTGTCTTCGGAAACCTTGGTGTAGTTGAACTGATAGTTACTGTTGTGACCTGAAGTTCACCATTA
  AAAGGGATTACCCAAGCAAAATCATGGAATGGTTATAAAAGTGATTGTTGGCACATCCTATGCAATATAT
  CTAAATTGAATAATGGTACCAGATAAAATTATAGATGGGAATGAAGCTTGTGTATCCATTATCATGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_031157.2
• Summary: 'This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016]'
• Locus ID: 3178