ROR1 (NM_001083592) Human 3' UTR Clone

CAT#: SC209269

3`UTR clone of receptor tyrosine kinase-like orphan receptor 1 (ROR1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ROR1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ROR1
Synonyms dJ537F10.1; NTRKR1
ACCN NM_001083592
Insert Size 729 bp
Sequence Data
>SC209269 3'UTR clone of NM_001083592
The sequence shown below is from the reference sequence of NM_001083592. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCTGATCTGTGTGACATCCCAGCGTGCGGTAAATAGAAGTCATTGCCCCTAATGTATTCAATCATCTTT
AAAGATCCCTATCCTACCCCTCTTATTTAGGAGAATCCTATAAGGGGGGCAAAGAAAATGGACAGTATTT
GCTTGATCTCAATCTGGTTTTAGGGTAAACCTTGCCGTTTCTACATAAAACACCTCGTAAGGTACCAAAA
CACGTTCTCAAGAAGTCAACTGCCTTTATACCTGCAGCCATTGCACTCATGGATGTAACAGGGACCCAGC
CCTTCAGAGGCACAGTTGAGACAGTTTATCACATTGATTTTTATAGAAAAAGATGTTACCCAGAATGGTC
TGCGTCCAAGTGGACCTTTTCAGCAAAAAAAGGAATATTGGAAGCAGGAAGAAATTGTTTTCTGTATGCC
TTAAGAACACCACAAGGCAGGATGAATCTACAACCATTACTCGGTCATCCAGGACAATCTGTGGGTAAAC
TGTGTCCTTCGTTATGTCTGTTAATACTGCAGAAGAAGCATATAGGTATCTAGTAAGAAAATGGAATTCC
TGAGTCAGTTAACTGTTCCTTTTTCTAGAAAATGTTTGGAGAAAATAATGAAAATGGGCCAAGCATGGTG
GCTTATACCTGTAATCCCAACACTCTAGGAAGGCCGAGGCAGGAGGATCATTTGAGCCCAGGGGTTCAAG
ACCAGCCCAGGCAACATAGTGAGACTCCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001083592.1
Summary 'This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]'
Locus ID 4919

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.