beta Arrestin 1 (ARRB1) (NM_004041) Human 3' UTR Clone

CAT#: SC209297

3`UTR clone of arrestin beta 1 (ARRB1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARRB1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARRB1
Synonyms ARB1; ARR1
ACCN NM_004041
Insert Size 772 bp
Sequence Data
>SC209297 3'UTR clone of NM_004041
The sequence shown below is from the reference sequence of NM_004041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGAAGAGGAGGATGGTACCGGCTCTCCACAGCTCAACAACAGATAGACGGGCCGGCCCTGCCTCCACGT
GGCTCCGGCTCCACTCTCGTGCACTCGGATGCTTACTCGTCTTCTTCCTGTTCTGGTTTCTTTTCCCCTT
TGTTCTTCCAGTTTCTACCAGGGGGCCCCGTGGGCTTCCAGATCACGGTGATGAACCTCTGGCCTCAGGA
TTGGCCCCACATCACCACGCCAACAGGACCACAGCGCACTGGCTCCACCCCATCTCTGCCATCTCCACTC
CCCTCCTTTTCATGCTGTCTCCCAGAAAAGCTGCCAGGGCTCTGGCCTTGGAATTGGACTTGAGATGGGG
AGCAGACAGGGGAGGATGGGGAATGTGGGACACGGTGTGGTGGGCATGAGGGCTTGGAGGGGTGGGGATG
AGGGCTCAAGACACGAGAGAAGATGTCCACGGTCCCAGGTGGTTAACAAAGTTCTGGCAGCTAAAAGATG
ACCGCGTTGAAGGCCACCTCCTTCTGGCTGGGAGGGGCAGAACTGTGGACAGATTCTCAATGCCTTTTTG
AAGTTCTGACCCACCAAAGACCTTCTGCCTTCACCCTCCTCCCCACCTGATGTCCCTCTGTGTCTGATAG
TGATGTTGGTGAAAGTTCGTAGACCCCAGGAGTAGAGAAAAGCAACTGGACTGACTTTCTTACCAGCAGT
TACCTAGACTGAGGCAAGCTGTGTGGACTCACCCAAGTATATTTCAGTACTGTCAGGCTGTGACATCTTA
GC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004041.3
Summary 'Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 1 is a cytosolic protein and acts as a cofactor in the beta-adrenergic receptor kinase (BARK) mediated desensitization of beta-adrenergic receptors. Besides the central nervous system, it is expressed at high levels in peripheral blood leukocytes, and thus the BARK/beta-arrestin system is believed to play a major role in regulating receptor-mediated immune functions. Alternatively spliced transcripts encoding different isoforms of arrestin beta 1 have been described. [provided by RefSeq, Jan 2011]'
Locus ID 408

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.