SLC25A31 (NM_031291) Human 3' UTR Clone

CAT#: SC209312

3`UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 31 (SLC25A31) nuclear gene encoding mitochondrial protein for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC25A31"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC25A31
Synonyms AAC4; ANT 4; ANT4; SFEC35kDa
ACCN NM_031291
Insert Size 735
Sequence Data
>SC209312 3'UTR clone of NM_031291
The sequence shown below is from the reference sequence of NM_031291. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGATATTGGTGGTAGGTAATCGGGAGAGTAAATTAAGAAATACATGGATTTAACTTGTTAAACATACAA
ATTACATAGCTGCCATTTGCATACATTTTGATAGTGTTATTGTCTGTATTTTGTTAAAGTGCTAGTTCTG
CAATAAAGCATACATTTTTTCAAGAATTTAAATACTAAAAATCAGATAAATGTGGATTTTCCTCCCACTT
AGACTCAAACACATTTTAGTGTGATATTTCATTTATTATAGGTAGTATATTTTAATTTGTTAGTTTAAAA
TTCTTTTTATGATTAAAAATTAATCATATAATCCTAGATTAATGCTGAAATCTAGGAAATGAAAGTAGCG
TCTTTTAAATTGCTATTCATTTAATATACCTGTTTTCCCATCTTTTGAAGTCATATGGTATGACATATTT
CTTAAAAGCTTATCAATAGATGTCATCATATGTGTAGGCAGAAATAAGCTTTGTTCTATATCTCTTCTAA
GACAGTTGTTATTACTGTGTATAATATTTACAGTATCAGCCTTTGATTATAGATGTGATCATTTAAAATT
TGATAATGACTTTAGTGACATTATAAAACTGAAACTGGAAAATAAAATGGCTTATCTGCTGATGTTTATC
TTTAAAATAAATAAAATCTTGCTAGTGTGAATATATCTTAGAACAAAAGGTATCCTCTTGAAAATTAGTT
TGTATATTTTGTTGACAATAAAGGAAGCTTAACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_031291.2
Summary The protein encoded by this gene is a member of the ADP/ATP carrier family of proteins that exchange cytosolic ADP for matrix ATP in the mitochondria. Cells over-expressing this gene have been shown to display an anti-apoptotic phenotype. This protein is also thought to play a role in spermatogenesis, where it is believed to associate with a part of the flagellar cytoskeleton and with glycolytic enzymes. Male mice with mutations in the mouse ortholog of this gene are sterile and spermatocytes display an early meiotic arrest phenotype. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Locus ID 83447

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.