ASK1 (MAP3K5) (NM_005923) Human 3' UTR Clone

CAT#: SC209333

3`UTR clone of mitogen-activated protein kinase kinase kinase 5 (MAP3K5) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP3K5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MAP3K5
Synonyms ASK1; MAPKKK5; MEKK5
ACCN NM_005923
Insert Size 732 bp
Sequence Data
>SC209333 3'UTR clone of NM_005923
The sequence shown below is from the reference sequence of NM_005923. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCACACTGTGGAAGGCTATCATTGACTTTCGAAACAAACAGACTTGACTGTTGCTCAATCTAATCTTCGA
TGGAAATTCTAAAAATTAATACAGAGCTGATCTTCTTGGGGGTGGGAAAATCGAAGGGAGAGGAGAAAGG
CGCTGCACTTTAAATCCAGTATTTGTTTACTCATGTTAAAAAAAAAAAAAACAGACAAAACACACTGAAA
TTTCCTAACTACATCTATTTCTATAATTTTTAAGGACTCTTCATAAGGACTCTTAAAATAATCCTGAACA
TTAGAACCCTAATGTTCAGGAAGATTTTAATCTAAGCATTTTTATGGAAATATTTTTAATGCAGCAGCTA
TTGCACTTCAGCCAAATGTTTATTTCACACAAAACGGATGTAACATTTCATGTGATCGTGCACCACTGGA
ACAAAACCAAAATGTGACCATAACTGTTTAGGCTTCTGTGTGTTTGTAATATGCTCTAATAATCTGAGTA
GAAATGCGTAATTTCAATTACTGTATAAAGTTTATGTTTTTTTAAGTGTGCAGAATCTGAGAGCAATGGT
TTTTACTTCTCTGTGTTAATTGTAATATTGACTCTATTTTGTAACTTAAGTTTCTGACCTGTCGTACATT
TGTTTGAGTCGTTTATGTACTACTGAACTGTACCAGTTGCACATGCTTGAACTGTAGTAATGTTAGCTTG
TTCTAAAGCTATCCATTGTGTCATATTTACTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005923.3
Summary 'Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]'
Locus ID 4217

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.