MCM4 (NM_182746) Human 3' UTR Clone

CAT#: SC209347

3`UTR clone of minichromosome maintenance complex component 4 (MCM4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MCM4
• Synonyms: CDC21; CDC54; hCdc21; IMD54; NKCD; NKGCD; P1-CDC21
• ACCN: NM_182746
• Insert Size: 746 bp
• Sequence Data:
  Insert Sequence

  >SC209347 3'UTR clone of NM_182746
  The sequence shown below is from the reference sequence of NM_182746. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCCTGACAGTGACTGGGAAGACCGTGCGCTTGCTCTGAAGCCTTGTGAGCAAGGAAGGCTCCCTGCATG
  TCCTGCTTGCTGCACGCCACATGGGTGTGGTCTGCATCTCAGTTGGCCGCCATCAGTGTAAATAGAGCTT
  AAAGTCATGGTTTGGCTGCATAAAAATTTTCTAACTTGGGTTCAATATTTGTAGTGAAGTATCTGTTTTC
  ATTTTTTTCACGTTATAAATAAAAATACTATGCTGGCCGGGCGCGGTGGCTCACACCTGTAATCCCAGCA
  CTTTGGGAGGCCAATGTGGGTGGATCATGAGGTCAGGAGTTCAAGACCAGCCTAGCCAAGATGGTGAAAC
  CCCGTCTCTAGTAAAGATAACAAAAAATTAGCTGGGCTTGATGGCATGCGCCTGTAATCCCAGCTACTCG
  GGAGGTTGAGGCAGGAGAATCGCTTAAACCCAGGCGGCAGAGGTTGCAGTGAGCCAAGATCGCGCCACTG
  CACTCCAGCCTCAGCAATAGAGTGAGACTGTCTCAAAAAAAAAAAAAAAAAAAAAACCTGCCAATTTTCA
  AACATACCGTAGAGATTATTTTCAGGTGCCATTTTATAGTATAGCAGCAGGGCTTTTACTCTGTGTATGC
  ACAGATGCAGTCTGGGGCATGGTTTGTGTGCTGGACTTTCTCATGGCCATCATCAGTATGCTTATGGATT
  TGATGACAGGCATAGCCTGGGCATATCACCTCATTGGTAAAGGGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_182746.1
• Summary: 'The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 4173