TRAF2 (NM_021138) Human 3' UTR Clone

CAT#: SC209375

3`UTR clone of TNF receptor-associated factor 2 (TRAF2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TRAF2
• Synonyms: MGC:45012; RNF117; TRAP; TRAP3
• ACCN: NM_021138
• Insert Size: 711 bp
• Sequence Data:
  Insert Sequence

  >SC209375 3'UTR clone of NM_021138
  The sequence shown below is from the reference sequence of NM_021138. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCATTGTGGACCTGACAGGGCTCTAACTGCCCCCTACTGGTGTCTGGGGGTTGGGGGCAGCCAGGCACA
  GCCGGCTCACGGAGGGGCCACCACGCTGGGCCAGGGTCTCACTGTACAAGTGGGCAGGGGCCGCGCTTGG
  GCGCTTGGGAGGGTGTCGGCCTGCAGCCAAGTTCACTGTCACGGGGGAAGGAGCCACCAGCCAGTCCTCA
  GATTTCAGAGACTGCGGAGGGGCTTGGCAGACGGTCTTAGCCAAGGGCTGTGGTGGCATTGGCCGAGGGT
  CTTCGGGTGCTTCCCAGCACAAGCTGCCCTTGCTGTCCTGTGCAGTGAAGGGAGAGGCCCTGGGTGGGGG
  ACACTCAGAGTGGGAGCACATCCCAGCAGTGCCCATGTAGCAGGAGCACAGTGGATGGCCTTGTGTCCCT
  CGGGCATGACAGGCAGAAACGAGGGCTGCTCCAGGAGAAGGGCCTCCTGCTGGCCAGAGCAAGGAAGGCT
  GAGCAGCTTGGTTCTCCCCTCTGGCCCCTGGAGAGAAGGGAGCATTCCTAGACCCCTGGGTGCTTGTCTG
  CACAGAGCTCTGGTCTGTGCCACCTTGGCCAGGCTGGCTGTGGGAGAGGGTCTGGTCCCACGCCGCCTCT
  GCTCAGACCACTGTGTGGGAGGTGCACAGCACAGCCTGCGGGTAAAGTGTGAGAGCTTGCCATCCAGCTC
  ACGAAGACAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021138.3
• Summary: 'The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]'
• Locus ID: 7186