KDEL Receptor (KDELR1) (NM_006801) Human 3' UTR Clone

CAT#: SC209443

3`UTR clone of KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 (KDELR1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KDELR1
• Synonyms: ERD2; ERD2.1; HDEL; PM23
• ACCN: NM_006801
• Insert Size: 723
• Sequence Data:
  Insert Sequence

  >SC209443 3'UTR clone of NM_006801
  The sequence shown below is from the reference sequence of NM_006801. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGGAAGAAGTTGAGTTTGCCGGCATAGCCCCGGTCCTCTCCATCTCTCTCCTCGGCAGCAGCGGGAGGCA
  GAGGAAGGCGGCAGAAGATGAAGAGCTTTCCCATCCAGGGGTGACTTTTTTAAGAACCCACCTCTTGTGC
  TCCCCATCCCGCCTCCTGCCGGGTTTCAGGGGGACAGTGGAGGATCCAGGTCTTGGGGAGCTCAGGACTT
  GGGCTGTTTGTAGTTTTTTGCCTTTTAGACAAGAAAAAAAAATCTTTCCACTCTTTAGTTTTTGATTCTG
  ATGACTCGTTTTTCTTCTACTCTGTGGCCCCAATTTTTATAAAGTGTTTTTGAGTGTCCTATGGGCCGGG
  GCAGGGTCCAAGATCTTTTCCCTTCCCCAGGCCCCTCGGCTCCCTCCCAGATCCCACCCCCAGCCCCACT
  GGTTGCCAAACACTAAATCTGCCGACACCCATCTGCCCCACCTCCTGCCATGGCCATGAACCGCGACCCC
  CACTAAATTTCTAGATTGGGGATAGGGAGAAAGGGAGGCCCAGGAAGGTCTCCCCTGATTTTTTTTCATA
  GTAATTTTTTTCCCCAGAGTTTGAATTTTTTGGTCTTCTCCTGGTTTTTTGGCAAATTAGGGGGGCCCGG
  GGCTCAAGTGCGGGAAGGGGGCTGGCCCGAGGATCCCATGGCTCTCACACCATGTTTTTGTACAGAACTG
  ATGGTTGAATCTTTGTTCTCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006801.2
• Summary: Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]
• Locus ID: 10945