QDPR (NM_000320) Human 3' UTR Clone

CAT#: SC209494

3`UTR clone of quinoid dihydropteridine reductase (QDPR) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "QDPR"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol QDPR
Synonyms DHPR; HDHPR; PKU2; SDR33C1
ACCN NM_000320
Insert Size 754 bp
Sequence Data
>SC209494 3'UTR clone of NM_000320
The sequence shown below is from the reference sequence of NM_000320. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTAACCACAGAAGGAAGGACGGAACTCACCCCAGCATATTTTTAGGCCTCATCTCAGTGCCTATGAGGG
GCCTGCCAGAAAAGTCACTAACCTGTCTCAGTGTGGCCTTGTCCAGCCTTGTGTTTTCTGTAACCCCTGT
TTGTGGTACGAGATAATGAGTCCTATTTTTCTCTCACATAATATGCATTTGCTCTCCTAGGACAGTGTAA
TACATTTATGTGAAGTAAAGACATGCGAGACTGGTGGCCTGCAAATAGCATCCGTTGATCTGTGTTAACT
GCATAGGGAGGGCTCTGCATAGCACCTGCTATAGCGGTGTCATGTTGGATCGCTTTTGTGACTGTTCATC
TGTCCTTGACAGTGGCTGTCATCTTGACTACTTTGTTGATTTGTTGGTATTGGGGACATTTTAAAGGCTG
AGTTATTTTTGAATGTCATGTTTATGTCATAGACGTAGTTTTCGCATCCTTGAATTAAACTGCCTTAACT
CCTTTTGTGGTATAAGCAAAACTACATGGACTCTGTCCTGGTATCCTTTTCCTGTGTGGTTGCCCCGTGT
CCTCTGGCCTAGGGTTAAGTGTGCAAGATAACTACTCGTGAGTATTCAGAATGTTGTTCCTAATAAATGC
ACTTGTTGTCTGTCTTCTTTAATCAAATCACATCTTATATACAGCAGTCAGAGATGAGTATACTAGAATC
ATGGATTGCTGGAGGTCTTTTAATCTGATGTTCTCAGAAGGGGGTGGATTTAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000320.2
Summary 'This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]'
Locus ID 5860

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.