FEN1 (NM_004111) Human 3' UTR Clone

CAT#: SC209529

3`UTR clone of flap structure-specific endonuclease 1 (FEN1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FEN1
• Synonyms: FEN-1; MF1; RAD2
• ACCN: NM_004111
• Insert Size: 766 bp
• Sequence Data:
  Insert Sequence

  >SC209529 3'UTR clone of NM_004111
  The sequence shown below is from the reference sequence of NM_004111. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGGCAAAGACTGGGGCAGCAGGGAAGTTTAAAAGGGGAAAATAAATGTGTTTCCCCATTATACCTCC
  TTCACCCCAGAATATTTGCCGTCTTGTACCCTTAAGAGCTACAGCTAGAGAAACCTTCACGGGGTGGAGA
  GAGGATTCTAAGGCTTTTCTAGCGTGACCCTTTTCAGTAGTGCTAGTCCCTTTTTTACTTGATCTTAATG
  GCAAGAAGGCCACAGAGGTACTTTTCCTTTTTTAGCTCAGGAAAATATGTCAGGCTCAAACCACTTCTCA
  GGCAGTTTAATGGACACTAAGTCCATTGTTACATGAAAGTGATAGATAGCAACAAGTTTTGGAGAAGAGA
  GAGGGAGATAAAAGGGGGAGACAAAAGATGTACAGAAATGATTTCCTGGCTGGCCAACTGGTGGCCAGTG
  GGAGGTGATGGTGGACCTAGACTGTGCTTTTCTGTCTTGTTCAGCCTTGACCCACCTTGAGAGAGAGCCA
  CCAGGAAGGCGCATCTTAGCAGATGGGAGGAACTGCTGAGAGAAGATGGGCAGAAAGCTGGAGCCCCTGG
  AGTTGGCTGTGTCTGTGTTTGTGACTGATTACTGGCTGTGTCTTGGGTGGGCAGAAACTCGAACTTGCTA
  TGTAATTTGTGTCTAGTTATTCAGAGGAGTAAGATGGTGATGTTCACCTGGCAATCAGCTGAGTTGAGAC
  TTTGGAATAAGACACTGGTTTTCATGCGCTGTTTTTGTTTTAAAGTTATGAAGAAAAAAGTCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004111.4
• Summary: 'The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]'
• Locus ID: 2237