UGT1A6 (NM_001072) Human 3' UTR Clone

CAT#: SC209596

3`UTR clone of UDP glucuronosyltransferase 1 family polypeptide A6 (UGT1A6) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT1A6
• Synonyms: GNT1; HLUGP; HLUGP1; hUG-BR1; UDPGT; UDPGT 1-6; UGT-1A; UGT-1C; UGT-1E; UGT1; UGT1-01; UGT1-03; UGT1-05; UGT1.1; UGT1.3; UGT1.5; UGT1A; UGT1A1; UGT1A3; UGT1A5; UGT1A6S; UGT1C; UGT1E; UGT1F
• ACCN: NM_001072
• Insert Size: 744
• Sequence Data:
  Insert Sequence

  >SC209596 3'UTR clone of NM_001072
  The sequence shown below is from the reference sequence of NM_001072. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCCACAAATCCAAGACCCATTGAGAAGTGGGTGGGAAATAAGGTAAAATTTTGAACCATTCCCTAGTC
  ATTTCCAAACTTGAAAACAGAATCAGTGTTAAATTCATTTTATTCTTATTAAGGAAATACTTTGCATAAA
  TTAATCAGCCCCAGAGTGCTTTAAAAAATTCTCTTAAATAAAAATAATAGACTCGCTAGTCAGTAAAGAT
  ATTTGAATATGTATCGTGCCCCCTCTGGTGTCTTTGATCAGGATGACATGTGCCATTTTTCAGAGGACGT
  GCAGACAGGCTGGCATTCTAGATTACTTTTCTTACTCTGAAACATGGCCTGTTTGGGAGTGCGGGATTCA
  AAGGTGGTCCCACGGCTGCCCCTACTGCAAATGGCAGTTTTAATCTTATCTTTTGGCTTCTGCAGATGGT
  TGCAATTGATCCTTAACCAATAATGGTCAGTCCTCATCTCTGTCGTGCTTCATAGGTGCCACCTTGTGTG
  TTTAAAGAAGGGAAGCTTTGTACCTTTAGAGTGTAGGTGAAATGAATGAATGGCTTGGAGTGCACTGAGA
  ACAGCATATGATTTCTTGCTTTGGGGAAAAAGAATGATGCTATGAAATTGGTGGGTGGTGTATTTGAGAA
  GATAATCATTGCTTATGTCAAATGGAGCTGAATTTGATAAAAACCCAAAATACAGCTATGAAGTGCTGGG
  CAAGTTTACTTTTTTTCTGATGTTTCCTACAACTAAAAATAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001072.3
• Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008]
• Locus ID: 54578