ADH4 (NM_000670) Human 3' UTR Clone

CAT#: SC209648

3`UTR clone of alcohol dehydrogenase 4 (class II) pi polypeptide (ADH4) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADH4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADH4
Synonyms ADH-2; HEL-S-4
ACCN NM_000670
Insert Size 784 bp
Sequence Data
>SC209648 3'UTR clone of NM_000670
The sequence shown below is from the reference sequence of NM_000670. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAACCAAGGAAAAAGCGTCCGAACAATCCTCATCTTTTGAAGATGCCAGGAGCAATTCAGAATACTATCT
GATTGAATGTGAACCTGCCTGGTTAATTTATTACCTGATTTGATGAACCAAGGAAAGCCATGAGTTTAAA
CAAATATTTACATTTAATATGGGAACATAAAAGAGCTTTAAATATTATAGACTTTGTACCTGTTATATAT
ATGAATATTCCCTATGTTAAATAATAATAATAACTAGTGTTTATGAATAGAATCATATCATCTTTAGAAA
TTGTTTAAAATTAGTTCTGGGAAGTTGAAAGTGGGGAATGAAGAGATAATAAATAAAACTAGATTGGCCA
TATGTTTATAATTTTTTTAGATTGGGTAATGAATACATGGAGTTTCATTATACTTTTCTCTCCACTTTTG
TCTATGTTGAAAATTTTCTGGGAGCTAAATGATGAGAACACATGGACACATGATGGGGAACAACACACAC
TGGGGCCTGTTGAGGGCAGGGAGTCGGCAGAGAGAGAGCATCAGGAAGAATAGCTAATGGATGCTGGGCT
TCATACCTGGGTGATGAGATGATCTGTGCAGCAAAGCACCATGGTACATGTTTACCTATGTAACAAACCT
GCACATCCTGCACATGTACCCTGGAACTTAATAAAAGTTGGAAATTTTTAAAAAGAATGAATAAGACCTG
GTATTTGATAGCACAACAGGGAGACTATAGTCAACAGCAATTTAATTGTATATTTTAATATGACTAAAAG
AGTATAATGGATTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000670.3
Summary 'This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]'
Locus ID 127

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.