Hexokinase 1 (HK1) (NM_033497) Human 3' UTR Clone

CAT#: SC209664

3`UTR clone of hexokinase 1 (HK1) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HK1
Synonyms hexokinase; HK; HK1-ta; HK1-tb; HK1-tc; HKD; HKI; HMSNR; HXK1; RP79
ACCN NM_033497
Insert Size 744 bp
Sequence Data
>SC209664 3'UTR clone of NM_033497
The sequence shown below is from the reference sequence of NM_033497. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTACGCACAGAGGCAAGCAGCTAAGAGTCCGGGATCCCCAGCCTACTGCCTCTCCAGCACTTCTCTCTTC
AAGCGGCGACCCCCTACCCTCCCAGCGAGTTGCGCTGGGAGACGCTGGCGCCAGGGCCTGCCGGCGCGGG
GAGGAAAGCAAAATCCAACTAATGGTATATATTGTAGGGTACAGAATAGAGCGTGTGCTGTTGATAATAT
CTCTCACCCGGATCCCTCCTCACTTGCCCTGCCACTTTGCATGGTTTGATTTTGACCTGGTCCCCCACGT
GTGAAGTGTAGTGGCATCCATTTCTAATGTATGCATTCATCCAACAGAGTTATTTATTGGCTGGAGATGG
AAAATCACACCACCTGACAGGCCTTCTGGGCCTCCAAAGCCCATCCTTGGGGTTCCCCCTCCCTGTGTGA
AATGTATTATCACCAGCAGACACTGCCGGGCCTCCCTCCCGGGGGCACTGCCTGAAGGCGAGTGTGGGCA
TAGCATTAGCTGCTTCCTCCCCTCCTGGCACCCACTGTGGCCTGGCATCGCATCGTGGTGTGTCAATGCC
ACAAAATCGTGTGTCCGTGGAACCAGTCCTAGCCGCGTGTGACAGTCTTGCATTCTGTTTGTCTCGTGGG
GGGAGGTGGACAGTCCTGCGGAAATGTGTCTTGTCTCCATTTGGATAAAAGGAACCAACCAACAAACAAT
GCCATCACTGGAATTTCCCACCGCTTTGTGAGCCGTGTCGTATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_033497.2
Summary 'Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]'
Locus ID 3098

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.