CYP2C18 (NM_001128925) Human 3' UTR Clone

CAT#: SC209675

3`UTR clone of cytochrome P450 family 2 subfamily C polypeptide 18 (CYP2C18) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP2C18"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP2C18
Synonyms CPCI; CYP2C; CYP2C17; P450-6B/29C; P450IIC17
ACCN NM_001128925
Insert Size 753 bp
Sequence Data
>SC209675 3'UTR clone of NM_001128925
The sequence shown below is from the reference sequence of NM_001128925. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTTGTACCAGCTCTGCTTCATTCCTGTCTGAAGAAGGGCAGATAGTTTGGCTGCTCCTGTGCTGTCACC
TGCAATTCTCCCTTATCAGGGCCATTGGCCTCTCCCTTCTCTCTGTGAGGGATATTTTCTCTGACTTGTC
AATCCACATCTTCCCATTCCCTCAAGATCCAATGAACATCCAACCTCCATTAAAGAGAGTTTCTTGGGTC
ACTTCCTAAATATATCTGCTATTCTCCATACTCTGTATCACTTGTATTGACCACCACATATGCTAATACC
TATCTACTGCTGAGTTGTCAGTATGTTATCACTAGAAAACAAAGAAAAATGATTAATAAATGACAATTCA
GAGCCATTTATTCTCTGCATGCTCTAGATAAAAATGATTATTATTTACTGGGTCAGTTCTTAGATTTCTT
TCTTTTGAGTAAAATGAAAGTAAGAAATGAAAGAAAATAGAATGTGAAGAGGCTGTGCTGGCCCTCATAG
TGTTAAGCACAAAAAGGGAGAAAGGTAAGAGGGTAGGAAAGCTGTTTTAGCTAAATGCCACCTAGAGTTA
TTGGAGGTCTGAATTTGGAAAAAAAAACTATGTCCAGGAGCAGCTGTAACCTGTAGGGAAATACTGGAAC
AATCATCCATAAGAGGGATGAACATTAAGTGTTTGAATTCATGCTCTGCTTTTGTGTTACTGTAAACACA
AGATCAAGATTTGGATAATCTTTTTCCTTTGTGTTTCCAACTTAGATCATGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001128925.1
Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 1562

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.