DAP5 (EIF4G2) (NM_001418) Human 3' UTR Clone

CAT#: SC209719

3`UTR clone of eukaryotic translation initiation factor 4 gamma 2 (EIF4G2) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "EIF4G2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EIF4G2
Synonyms AAG1; DAP5; NAT1; P97
ACCN NM_001418
Insert Size 789 bp
Sequence Data
>SC209719 3'UTR clone of NM_001418
The sequence shown below is from the reference sequence of NM_001418. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGGAAGAAGCTGACTAAAGAACCAGCCAAAGCCTTAAATTGTGCAAAACATACTGTTGCTATGATGT
AACTGCATTTGACCTAACCACTGCGAAAATTCATTCCGCTGTAATGTTTTCACAATATTTAAAGCAGAAG
CACGTCAGTTAGGATTTCCTTCTGCATAAGGTTTTTTTGTAGTGTAATGTCTTAATCATAGTCTACCATC
AAATATTTTAGGAGTATCTTTAATGTTTAGATAGTATATTAGCAGCATGCAATAATTACATCATAAGTTC
TCAAGCAGAGGCAGTCTATTGCAAGGACCTTCTTTGCTGCCAGTTATCATAGGCTGTTTTAAGTTAGAAA
ACTGAATAGCAACACTGAATACTGTAGAAATGCACTTTGCTCAGTAATACTTGAGTTGTTGCAATATTTG
ATTATCCATTTGGTTGTTACAGAAAAATTCTTAACTGTAATTGATGGTTGTTGCCGTAATAGTATATTGC
CTGTATTTCTACCTCTAGTAATGGGCTTTATGTGCTAGATTTTAATATCCTTGAGCCTGGGCAAGTGCAC
AAGTCTTTTTAAAAGAAACATGGTTTACTTGCACAAAACTGATCAGTTTTGAGAGATCGTTAATGCCCTT
GAAGTGGTTTTTGTGGGTGTGAAACAAATGGTGAGAATTTGAATTGGTCCCTCCTATTATAGTATTGAAA
TTAAGTCTACTTAATTTATCAAGTCATGTTCATGCCCTGATTTTATATACTTGTATCTATCAATAAACAT
TGTGATACTTGATGTAGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001418.3
Summary 'Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G that contains the binding sites for eIF4A and eIF3; eIF4G, in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G, which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. In vitro and in vivo studies indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]'
Locus ID 1982

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.