DAP5 (EIF4G2) (NM_001042559) Human 3' UTR Clone

CAT#: SC209720

3`UTR clone of eukaryotic translation initiation factor 4 gamma 2 (EIF4G2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EIF4G2
• Synonyms: AAG1; DAP5; NAT1; P97
• ACCN: NM_001042559
• Insert Size: 789 bp
• Sequence Data:
  Insert Sequence

  >SC209720 3'UTR clone of NM_001042559
  The sequence shown below is from the reference sequence of NM_001042559. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAGGAAGAAGCTGACTAAAGAACCAGCCAAAGCCTTAAATTGTGCAAAACATACTGTTGCTATGATGT
  AACTGCATTTGACCTAACCACTGCGAAAATTCATTCCGCTGTAATGTTTTCACAATATTTAAAGCAGAAG
  CACGTCAGTTAGGATTTCCTTCTGCATAAGGTTTTTTTGTAGTGTAATGTCTTAATCATAGTCTACCATC
  AAATATTTTAGGAGTATCTTTAATGTTTAGATAGTATATTAGCAGCATGCAATAATTACATCATAAGTTC
  TCAAGCAGAGGCAGTCTATTGCAAGGACCTTCTTTGCTGCCAGTTATCATAGGCTGTTTTAAGTTAGAAA
  ACTGAATAGCAACACTGAATACTGTAGAAATGCACTTTGCTCAGTAATACTTGAGTTGTTGCAATATTTG
  ATTATCCATTTGGTTGTTACAGAAAAATTCTTAACTGTAATTGATGGTTGTTGCCGTAATAGTATATTGC
  CTGTATTTCTACCTCTAGTAATGGGCTTTATGTGCTAGATTTTAATATCCTTGAGCCTGGGCAAGTGCAC
  AAGTCTTTTTAAAAGAAACATGGTTTACTTGCACAAAACTGATCAGTTTTGAGAGATCGTTAATGCCCTT
  GAAGTGGTTTTTGTGGGTGTGAAACAAATGGTGAGAATTTGAATTGGTCCCTCCTATTATAGTATTGAAA
  TTAAGTCTACTTAATTTATCAAGTCATGTTCATGCCCTGATTTTATATACTTGTATCTATCAATAAACAT
  TGTGATACTTGATGTAGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001042559.2
• Summary: 'Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G that contains the binding sites for eIF4A and eIF3; eIF4G, in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G, which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. In vitro and in vivo studies indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]'
• Locus ID: 1982