ERCC8 (NM_000082) Human 3' UTR Clone

CAT#: SC209828

3`UTR clone of excision repair cross-complementing rodent repair deficiency complementation group 8 (ERCC8) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ERCC8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ERCC8
Synonyms CKN1; CSA; UVSS2
ACCN NM_000082
Insert Size 800 bp
Sequence Data
>SC209828 3'UTR clone of NM_000082
The sequence shown below is from the reference sequence of NM_000082. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCTTTGAAGATGCCTGGAGCAGCAGTGATGAAGAAGGATGAATATCATCTTTAGTACCTTTTTGTCTCT
GCTGAAACTTTTTAAATGAGACTGTGTTTTTTTCAACTGTATGGTCTATTCCTGACAGCTAAATTAGCCC
TAAATGTGGGTAATATTTTTCCTCATGTTTTAAAATGAGGTTAATATTTGCATAAAATCCTAAAACAGAC
TTCTGTATAGTTTATTTAGTCAAAATGTGTTCCTTGATCCCAGATGTTGTGGCCTGGGAAAGCCCTCATT
GCTACAGTACAAGTAACACAAGTCGTTGTACCTCAGTTGTGACCTTCAGCAGATTTTATGAACTATAAGA
TGCAGTCTCAGAGGATCAGCAAGTGGAGGCCATCAGTATTGACTTTCTCTTACTTGCTGTACTATCAGCC
TGCTCGTTTCCACCTTTAAGAATGATTTTGCCAAGAATGATTATATCAAAAATAGTAGTTGAAATGGTAA
CATCAAAATTATTTTATTCTTTCTTCTTCATGTATTCACATTTTTCAGTGGTTTCATTTAATTAACCATG
CTTTATGTTAAACATTTTGGGGCTCAATGTCTCCTACTATCCAAAATGTGCATCACAGGAGGCTTTTAAC
TTTGTGAAAATCCCATGTTTGCTTTATTTTATTTTAATGTCAGAAGGCAGTTTGCGCTAATGCTTGAACT
CTTTTTCTGTGAAACTCATTAAGGTATGACCAAATCCTGCCTCATTAATTCAAGCAGAAAATATCCTGGC
AGGGAATCTGGCTTAAACATGAAATGCTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000082.3
Summary 'This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]'
Locus ID 1161

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.