CACNA1H (NM_001005407) Human 3' UTR Clone

CAT#: SC209876

3`UTR clone of calcium channel voltage-dependent T type alpha 1H subunit (CACNA1H) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNA1H"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNA1H
Synonyms CACNA1HB; Cav3.2; ECA6; EIG6; HALD4
ACCN NM_001005407
Insert Size 777 bp
Sequence Data
>SC209876 3'UTR clone of NM_001005407
The sequence shown below is from the reference sequence of NM_001005407. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCAGATGACCCCGTGTAGCTCGGGGCTTGGTGCCGCCCACGGCTTTGGCCCTGGGGTCTGGGGGCCCCG
CTGGGGTGGAGGCCCAGGCAGAACCCTGCATGGACCCTGACTTGGGTCCCGTCGTGAGCAGAAAGGCCCG
GGGAGGATGACGGCCCAGGCCCTGGTTCTCTGCCCAGCGAAGCAGGAGTAGCTGCCGGGCCCCACGAGCC
TCCGTCCGTTCTGGTTCGGGTTTCTCCGAGTTTTGCTACCAGCCGAGGCTGTGCGGGCAACTGGGTCAGC
CTCCCGTCAGGAGAGAAGCCGCGTCTGTGGGACGAAGACCGGGCACCCGCCAGAGAGGGGAAGGTACCAG
GTTGCGTCCTTTCAGGCCCCGCGTTGTTACAGGACACTCGCTGGGGGCCCTGTGCCCTTGCCGGCGGCAG
GTTGCAGCCACCGCGGCCCAATGTCACCTTCACTCACAGTCTGAGTTCTTGTCCGCCTGTCACGCCCTCA
CCACCCTCCCCTTCCAGCCACCACCCTTTCCGTTCCGCTCGGGCCTTCCCAGAAGCGTCCTGTGACTCTG
GGAGAGGTGACACCTCACTAAGGGGCCGACCCCATGGAGTAACGCGCCCGGCCCCGATGCGAATCAGGCC
TCCCCTACATCTGGGGGCGTTGGCCGCGAGATTCCCATTGACACCTTTGTTTCGTGTGCTTTTAAATTCA
GGTTAAATGTTGCAATAATCTGATGCAGAAGACTCAGCTTCTCAAGGGAGAGGGAGGGGGCGGAGCGGAA
TAAATAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001005407.1
Summary This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]
Locus ID 8912

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.