CDC42 (NM_044472) Human 3' UTR Clone

CAT#: SC209889

3`UTR clone of cell division cycle 42 (GTP binding protein 25kDa) (CDC42) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDC42
• Synonyms: CDC42Hs; G25K; TKS
• ACCN: NM_044472
• Insert Size: 785 bp
• Sequence Data:
  Insert Sequence

  >SC209889 3'UTR clone of NM_044472
  The sequence shown below is from the reference sequence of NM_044472. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAAACTCAACCCAAAAGGAAGTGCTGTATATTCTAAACTGTTTTCTCCTTCCCTTCTTTGCTGCTGCT
  TCCTGTCCCACTACTGTAGAAAGATCGTTTAAAAACAAAGGAATAAAACCATCCTGTTTGAAAGCCTCTG
  CGTCTTTTTACTCACCACCTTAGAGCAACCTCTGTATTAGTTTTTGATCAAGAATGCAATATCATATAAA
  TTTTTTGTGATCAGTAGTCAAGTTGGACTTGTTTTAACGTTCTGCTGCTTGAGTTGCCTGATGCTCAGAG
  CTTTTTGGTTTGGATTACTATTGCAAAAGGGAACTTGGTCTGGCTTTAAGAATGTCCTCTTGGAGAAAAT
  AACAAGAGTTTTAACACTTCTAGATCTTAGTTCTAGATGGAGAAAGTAACACAAACATCATTTTACTCTT
  ATGATCAATTGTTAATTGTAATTGCATGACAAACCTTATGGAAAAGGGGTGACCTAGTAGAGTGTAATGG
  GGAAGGGAGGATTCTTTTCTGGTTTTCCTTTGTGCGGTGAAACTTTGTGTTGCTGTTGCTTTGGCTGTCT
  GTGCTGTAGTGGAGTATTTGTCAGTCTGGGGTGGGGAAGATATTGATGTATCTGCTACTGCTTTATGAGT
  TCATTTGTTACATTATCTTTTAAGAATAACATCCATTTAAACAGTTGACTTACAGTTTGTTAATGCTGAG
  ATGTAAAGCTGCCACCTTTATATTTTCCTGCTTCTGATTTTATTGTGAGGGAAATATACAATTGTGGTTA
  CCTTCAAATTTTGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_044472.2
• Summary: 'The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. [provided by RefSeq, Apr 2013]'
• Locus ID: 998