BPGM (NM_199186) Human 3' UTR Clone

CAT#: SC210004

3`UTR clone of 23-bisphosphoglycerate mutase (BPGM) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BPGM"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BPGM
Synonyms DPGM; ECYT8
ACCN NM_199186
Insert Size 819 bp
Sequence Data
>SC210004 3'UTR clone of NM_199186
The sequence shown below is from the reference sequence of NM_199186. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTAGAAGATCAAGGAAAAGTGAAACAAGCTAAAAAATAGTCTTTCTCAACTGTTGGCTAAGAAGAAATGC
AAAAGAAGTGGCATAGGAGTGTGTTATGGGTGCTGAACTCTCTCTCTTTTTCCCCGATTTTCCAGAGCTA
GGCTGTGGAGTAGAGTTTGTATAGGTAACTAGGTAACTTATTGTGGCCCAGATAAGGCTTTAGGATGCCT
CAGTGCTTATGTCATAGCCTTATGAGTTAGCTTTCTTGCTAGCCCCCTAGTCGGTCACCAAACTAGTAAC
TAGTGGGGCTTAATGAAGGTCATAAGTTTCTGAGATGGGAGAGCAACAAGTAGAGATGAAGTTAAAGGTA
TTTATCATTCAAGAAATCATTATTGAGTCACCATTGACAGGCACTATTCTAATCAGTAGTTCACTTTAAT
ATTTAATAAGATTTTCTGGGATAACAGTAAGGGATATTAGATAATATACCGTATGTATTTATTACTAGTC
TTTTCCTCTAGGAAAAGGGATACTTTGATAATTAAGGCCAGAGGCCCATTAGTTGAGAAAGTCACAGATA
TATTTCTCCAAGAAAGCCAACAACCACCACCACAATGACAGAAATGACAACAAGGCCCTTTAACTTGTCT
TCTAGTTTAGAGACATCCTTCATTTGACATTTAGTAGAATTCCTCTTTGGCCACAAGAATAAGCAGCAAA
TAAACAACTATGGCTGTTGAGGTTCTCATTTTGGTTTGTTTTAATTTTTTGAACTTTGGGTACCTGTAAT
TAGTTTAAAAATAAAGTTCCTGATAATAAAGTGACTGAAAATGGCATCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_199186.2
Summary '2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]'
Locus ID 669

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.