XPC (NM_001145769) Human 3' UTR Clone

CAT#: SC210028

3`UTR clone of xeroderma pigmentosum complementation group C (XPC) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol XPC
Synonyms RAD4; XP3; XPCC
ACCN NM_001145769
Insert Size 809 bp
Sequence Data
>SC210028 3'UTR clone of NM_001145769
The sequence shown below is from the reference sequence of NM_001145769. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGTTCCCATTTGAGCAGCTGTGAGCTGAGCGCCCACTAGAGGGGCACCCACCAGTTGCTGCTGCCCCAC
TACAGGCCCCACACCTGCCCTGGGCATGCCCAGCCCCTGGTGGTGGGGGCTTCTCTGCTGAGAAGGCAAA
CTGAGGCAGCATGCACGGAGGCGGGGTCAGGGGAGACGAGGCCAAGCTGAGGAGGTGCTGCAGGTCCCGT
CTGGCTCCAGCCCTTGTCAGATTCACCCAGGGTGAAGCCTTCAAAGCTTTTTGCTACCAAAGCCCACTCA
CCCTTTGAGCTACAGAACACTTTGCTAGGAGATACTCTTCTGCCTCCTAGACCTGTTCTTTCCATCTTTA
GAAACATCAGTTTTTGTATGGAAGCCACCGGGAGATTTCTGGATGGTGGTGCATCCGTGAATGCGCTGAT
CGTTTCTTCCAGTTAGAGTCTTCATCTGTCCGACAAGTTCACTCGCCTCGGTTGCGGACCTAGGACCATT
TCTCTGCAGGCCACTTACCTTCCCCTGAGTCAGGCTTACTAATGCTGCCCTCACTGCCTCTTTGCAGTAG
GGGAGAGAGCAGAGAAGTACAGGTCATCTGCTGGGATCTAGTTTTCCAAGTAACATTTTGTGGTGACAGA
AGCCTAAAAAAAGCTAAAATCAGGAAAGAAAAGGAAAAATACGAATTGAAAATTAAGGAAATGTTAGTAA
AATAGATGAGTGTTAAACTAGATTGTATTCATTACTAGATAAAATGTATAAAGCTCTCTGTACTAAGGAG
AAATGACTTTTATAACATTTTGAGAAAATAATAAAGCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001145769.1
Summary 'The protein encoded by this gene is a key component of the XPC complex, which plays an important role in the early steps of global genome nucleotide excision repair (NER). The encoded protein is important for damage sensing and DNA binding, and shows a preference for single-stranded DNA. Mutations in this gene or some other NER components can result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]'
Locus ID 7508

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.