PTPN12 (NM_001131009) Human 3' UTR Clone

CAT#: SC210049

3`UTR clone of protein tyrosine phosphatase non-receptor type 12 (PTPN12) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTPN12"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PTPN12
Synonyms PTP-PEST; PTPG1
ACCN NM_001131009
Insert Size 799 bp
Sequence Data
>SC210049 3'UTR clone of NM_001131009
The sequence shown below is from the reference sequence of NM_001131009. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGGACCAAGAGATCCACCTTCAGAATGGACATGATTCAGGGAGCTAGAAGACACTTTAAGTTATACTGG
AAAATTCAGGTGCCACTGAAAGCCAGATTTATAGTATTCCATCTTTAATATGTGGGACTAACAGCAGTGT
AGATTGTTACCTTAATATTTTTTGCTGGGACCATCTACCTGCCTTATACTACACTTAGGAAAAAGTATTA
CATATGGTTTATTTTGAAACTTCAAGTATTATTGCCTTAATGTCTCTTAACCCTGTTACACGCTGCTTGT
AGACATGTTAATATAGTAATACCTTTATGATATATTGAGTTTAAGGACTACTCTTTTTCTGTTTTATCAT
GTATGCATTATTTTGTATATGTACAGGGCAAGTAGGTATATAATTTGATAAAGTTGCAATTGAAATATTA
TTAACAGAAGATGTAAGAAATTTCTGCATGGTCTAAATCTTTGTGTACTTTATTTGTAAATTATTTGCCC
TGGAGTTTTAGAAAATAGTTTCTGAATTTTAAACTTGCTGGATTCATGCAGCCAGCTTTGCAGGTTATCA
GAGATCAAAGATTGTAATAATAATTTTGTAAATTGTAAGCAAAAAGTTATTTTTATATTATATACAGTCT
AATTGTTCATCCTAATTGTTCCTGTTTTCATCTAGTCAGAGATTCAGTAAGTGCCTTGGAACAATATTGA
ATTCTCTTAGCTTGTGTGTGTTTCTTTAATATTTGAACTCAAGTGGGATTAGAAGACTATCAAAATACAT
GTATGTTTCAGGATATTTGACCTGTCATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001131009.1
Summary 'The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]'
Locus ID 5782

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.