Aspartate beta hydroxylase (ASPH) (NM_001164756) Human 3' UTR Clone

CAT#: SC210271

3`UTR clone of aspartate beta-hydroxylase (ASPH) transcript variant 12 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASPH"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ASPH
Synonyms AAH; BAH; CASQ2BP1; FDLAB; HAAH; JCTN; junctin
ACCN NM_001164756
Insert Size 837 bp
Sequence Data
>SC210271 3'UTR clone of NM_001164756
The sequence shown below is from the reference sequence of NM_001164756. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTTCAGGGAAAGACTTGTGTCATATTGGATTTACATAACCAGTAACCTTGATTCAGGGACTGAAGTCAT
TGGCTAATGAACACCTGAAGCAGCCTCCTTTTTCTTTTCTTTCCTTGGCTTATGCAGGGCTTAATGTGCA
GTGGGGTGGTTGTGATCTTACCGTGCAAGTCAACCATGTGATCTTGCCCAGTACAGCTACTAGCTAGTCC
CTTGCTCGCTCAGCTCCCCCAACTTCTATTGAAGAAAATGGTACTCCTCATTCTTGTAGTCAGCTACAAA
GTACACTGAAAATGATGTTCTTGGTGGTATAATTGGTTTCTGTATCGTTTTGTTTCAACTCATGTATTCA
CTGAACTAAATTTGGACACTTAACAGCAAATTGTGTTGTGGTTAACCCTTGATGCTTGTCTTTCTAACAC
ACTATTAATTATGATGATTCTAATGGATTTCATTATAAAAATATTTCTGGCATGATTTTTAAGTTAAATG
CTTCTCTGTTCTTTAACATGACTGATGTATAAAATGATGGTTCTTTACTAAGCTGATATTTTTTATTGTA
ATTTGTTTAGGTTTGTCAGATAGGTTCATACAAATTTCTATGTAAAATTCTGTGTTAATGGTGCTTTTAA
AATAATTTAAAAATAACTCCATGTTTTTGCCTTAGAGTAAGTTAACTTACTGTTTTCAGATAGTAGCATG
ACATATTTCTGTCTGTGAAAGCAAAATTTATTTTAAATTTTATTTCCAAATATACATCCAGAGAAAGTAA
TTTGTATTTTTTTTAAAGTAGGCATATTACACAAGAGGGAACATGTGAATATGTATCTTAATGTTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001164756.1
Summary 'This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]'
Locus ID 444

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.