SDHD (NM_003002) Human 3' UTR Clone

CAT#: SC210371

3`UTR clone of succinate dehydrogenase complex subunit D integral membrane protein (SDHD) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDHD"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SDHD
Synonyms CBT1; CII-4; CWS3; cybS; PGL; PGL1; QPs3; SDH4
ACCN NM_003002
Insert Size 853 bp
Sequence Data
>SC210371 3'UTR clone of NM_003002
The sequence shown below is from the reference sequence of NM_003002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAAAGCTGTTGCCATGCTGTGGAAGCTCTGACCTTTTTGACTTCATACTTTGAAGAATTGATGTATGCC
TCTTTGCCTCTGCTTTGTCATGCCATTAAGCTCACAATAAGGAAGAAATAACAGATAAGTCCATTGGTGG
ACAGCCTTCTTCTCTTAATCACAAGATTATTTTCAGAATTTAATCTTTGAGGAAAAGGTTTGAGAGGAAT
TATATCTAAGTTGTGAGACTGAGTTCTATATTCTGGTGAGTTAATGGGGTTGCCTCCCAGCTTCTTATAA
GACTCACAGTATAACTAAACATGATATATCAGCTTTTGCCTTTCAATTTATCAATCTCTTAAAGAGAATC
CAACTTTATTACGATTAGTATATGATCAAACTTCCATATTTGCCTTGGGAATAATGGACAAAGGGAAATA
CTCTTAATTCATGAATAAAAACTTTGCAGAAAATTAGACAGTGTTTAATTTTCGAAAACTTCCCTCTCTA
GACAGTAGATACCACCTACTGATGGTTACATATACTAGGGAAATTTTAAAATTAGGAAATGCTGATAGCT
CATATTATAAATTTCTAAATCCTAGGAAGAAACGCTTGGAGTGCTTCTGAATATACAGAAGTTCCATTTA
AGGGCAAGTTTCCCTGTAGATGTATCAAAATACTACCAACTGTAAATTGAGATTTAATTCCCAAATGTAT
TCTACTTGTTCTAAAACAATCTGTCCACAAATATAAAACTATAAGTAATAAATTGTTATTTTCGCACAAT
GGGAATCTCTAATGTGAAAATGTATTCTATGAAAATAATTTTTTTAAATAAAATGTTATATAATAAAAGT
GTCTTCTATGCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003002.2
Summary 'This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]'
Locus ID 6392

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.