CD40 (NM_152854) Human 3' UTR Clone

CAT#: SC210584

3`UTR clone of CD40 molecule TNF receptor superfamily member 5 (CD40) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD40
• Synonyms: Bp50; CDW40; p50; TNFRSF5
• ACCN: NM_152854
• Insert Size: 863 bp
• Sequence Data:
  Insert Sequence

  >SC210584 3'UTR clone of NM_152854
  The sequence shown below is from the reference sequence of NM_152854. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAAAGGTGGCCAAGAAGCCAACCAATAAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCC
  CGACGATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGTCACC
  CAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGT
  GGCCACGTGGGCAAACAGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTGAGGG
  GCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCTGCACCCCTGCAGTTTGAGACAGGAGACCTGGCA
  CTGGATGCAGAAACAGTTCACCTTGAAGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTT
  GTATTAAAGACAGAGGCAGAAGTTTGGTGGTGGTGGTGTTGGGGTATGGTTTAGTAATATCCACCAGACC
  TTCCGATCCAGCAGTTTGGTGCCCAGAGAGGCATCATGGTGGCTTCCCTGCGCCCAGGAAGCCATATACA
  CAGATGCCCATTGCAGCATTGTTTGTGATAGTGAACAACTGGAAGCTGCTTAACTGTCCATCAGCAGGAG
  ACTGGCTAAATAAAATTAGAATATATTTATACAACAGAATCTCAAAAACACTGTTGAGTAAGGAAAAAAA
  GGCATGCTGCTGAATGATGGGTATGGAACTTTTTAAAAAAGTACATGCTTTTATGTATGTATATTGCCTA
  TGGATATATGTATAAATACAATATGCATCATATATTGATATAACAAGGGTTCTGGAAGGGTACACAGAAA
  ACCCACAGCTCGAAGAGTGGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_152854.2
• Summary: 'This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]'
• Locus ID: 958