MCK10 (DDR1) (NM_013993) Human 3' UTR Clone

CAT#: SC210703

3`UTR clone of discoidin domain receptor tyrosine kinase 1 (DDR1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DDR1
• Synonyms: CAK; CD167; DDR; EDDR1; HGK2; MCK10; NEP; NTRK4; PTK3; PTK3A; RTK6; TRKE
• ACCN: NM_013993
• Insert Size: 864 bp
• Sequence Data:
  Insert Sequence

  >SC210703 3'UTR clone of NM_013993
  The sequence shown below is from the reference sequence of NM_013993. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGGATGCACTCAACACGGTGTGAATCACACATCCAGCTGCCCCTCCCTCAGGGAGCGATCCAGGGGAA
  GCCAGTGACACTAAAACAAGAGGACACAATGGCACCTCTGCCCTTCCCCTCCCGACAGCCCATCACCTCT
  AATAGAGGCAGTGAGACTGCAGGTGGGCTGGGCCCACCCAGGGAGCTGATGCCCCTTCTCCCCTTCCTGG
  ACACACTCTCATGTCCCCTTCCTGTTCTTCCTTCCTAGAAGCCCCTGTCGCCCACCCAGCTGGTCCTGTG
  GATGGGATCCTCTCCACCCTCCTCTAGCCATCCCTTGGGGAAGGGTGGGGAGAAATATAGGATAGACACT
  GGACATGGCCCATTGGAGCACCTGGGCCCCACTGGACAACACTGATTCCTGGAGAGGTGGCTGCGCCCCC
  AGCTTCTCTCTCCCTGTCACACACTGGACCCCACTGGCTGAGAATCTGGGGGTGAGGAGGACAAGAAGGA
  GAGGAAAATGTTTCCTTGTGCCTGCTCCTGTACTTGTCCTCAGCTTGGGCTTCTTCCTCCTCCATCACCT
  GAAACACTGGACCTGGGGGTAGCCCCGCCCCAGCCCTCAGTCACCCCCACTTCCCACTTGCAGTCTTGTA
  GCTAGAACTTCTCTAAGCCTATACGTTTCTGTGGAGTAAATATTGGGATTGGGGGGAAAGAGGGAGCAAC
  GGCCCATAGCCTTGGGGTTGGACATCTCTAGTGTAGCTGCCACATTGATTTTTCTATAATCACTTGGGGT
  TTGTACATTTTTGGGGGGAGAGACACAGATTTTTACACTAATATATGGACCTAGCTTGAGGCAATTTTAA
  TCCCCTGCACTAGGCAGGTAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013993.2
• Summary: 'Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]'
• Locus ID: 780