Glutathione Peroxidase 3 (GPX3) (NM_002084) Human 3' UTR Clone

CAT#: SC210760

3`UTR clone of glutathione peroxidase 3 (plasma) (GPX3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GPX3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GPX3
Synonyms GPx-P; GSHPx-3; GSHPx-P
ACCN NM_002084
Insert Size 900 bp
Sequence Data
>SC210760 3'UTR clone of NM_002084
The sequence shown below is from the reference sequence of NM_002084. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTCCTACATGAGGCGGCAGGCAGCCCTGGGGGTCAAGAGGAAGTAACTGAAGGCCGTCTCATCCCATGT
CCACCATGTAGGGGAGGGACTTTGTTCAGGAAGAAATCCGTGTCTCCAACCACACTATCTACCCATCACA
GACCCCTTTCCTATCACTCAAGGCCCCAGCCTGGCACAAATGGATGCATACAGTTCTGTGTACTGCCAGG
CATGTGGGTGTGGGTGCATGTGGGTGTTTACACACATGCCTACAGGTATGCGTGATTGTGTGTGTGTGCA
TGGGTGTACAGCCACGTGTCTACCTATGTGTCTTTCTGGGAATGTGTACCATCTGTGTGCCTGCAGCTGT
GTAGTGCTGGACAGTGACAACCCTTTCTCTCCAGTTCTCCACTCCAATGATAATAGTTCACTTACACCTA
AACCCAAAGGAAAAACCAGCTCTAGGTCCAATTGTTCTGCTCTAACTGATACCTCAACCTTGGGGCCAGC
ATCTCCCACTGCCTCCAAATATTAGTAACTATGACTGACGTCCCCAGAAGTTTCTGGGTCTACCACACTC
CCCAACCCCCCACTCCTACTTCCTGAAGGGCCCTCCCAAGGCTACATCCCCACCCCACAGTTCTCCCTGA
GAGAGATCAACCTCCCTGAGATCAACCAAGGCAGATGTGACAGCAAGGGCCACGGACCCCATGGCAGGGG
TGGCGTCTTCATGAGGGAGGGGCCCAAAGCCCTTGTGGGCGGACCTCCCCTGAGCCTGTCTGAGGGGCCA
GCCCTTAGTGCATTCAGGCTAAGGCCCCTGGGCAGGGATGCCACCCCTGCTCCTTCGGAGGACGTGCCCT
CACCCCTCACTGGTCCACTGGCTTGAGACTCACCCCGTCTGCCCAGTAAAAGCCTTTCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002084.3
Summary 'The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted, and is abundantly found in plasma. Downregulation of expression of this gene by promoter hypermethylation has been observed in a wide spectrum of human malignancies, including thyroid cancer, hepatocellular carcinoma and chronic myeloid leukemia. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]'
Locus ID 2878

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.