Carbonic Anhydrase III (CA3) (NM_005181) Human 3' UTR Clone

CAT#: SC210807

3`UTR clone of carbonic anhydrase III muscle specific (CA3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CA3
Synonyms CAIII; Car3
ACCN NM_005181
Insert Size 893 bp
Sequence Data
>SC210807 3'UTR clone of NM_005181
The sequence shown below is from the reference sequence of NM_005181. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TAACAGGGTGGTGAGAGCTTCCTTCAAATGAGGCTGCTGGATCTTGCCCTCTTCAGGAAAGGAAACCTAC
CATTGGAGAGCTTGGTTCCTTGCCTCCTTCTGGTGCTCCTTACTCCAAGTCTATTTCATTTTTCCACACT
GAGCAATGAATGTGAGAGATGTGGTCACCAAGATCTAAGTTACTTGTTGAAAGAAAGTTACTTTCGACAA
GATCTAATATGAAAGCATAGATTTCACATTTGATCTCTGTAATAATCATCTTTCCTATAAAAGTAGCATT
TTTGGTAAAGTTTCAAAGAAGAAGAAACAGAGATGGAAGAGTAAAGATATTTTTAAAATGGCTAGCTATT
GGGCACCAGTTTTTCTGTTATCTAAAATTTCACACAACTTCATTGTTTTTATTTTTATATTATGAGTTGT
CCATCTTAAAGAAATATGAGTAATTCTACATGTAGTAGAGGTGTATGAAGATCATATAACAATTAAACAT
AAGCCAGAAATTAAAATGACTATAGACAGCAAGAATTGAGCTAATAATATGTTTTAACTCTTAACACCAG
CAAGAAGTCAGTCATTTATTGAAGTTTTAGCTACTAAGATTACTTGGTTTTGATTACCAGTGAAAAGAAA
ACACAATACAATCAGGAGTTTTCAAATTTTTGATTCAGTATTTGAATTTCTTCTTCATAAATGTAGTTGA
ATTTATCCTAGTATTTTTCTTTACCTGAAGGAGGGCCATTTATTTTTAATTTCACTACATTTTTCTTTGC
ATGATTATTAAAATAAAAACTGCCTCTGTTGTGTTTCTCACTGGAGGCTGGAATGAATGATCACTAGAAC
ACAAAAGAGTGAATGATGACACTTGAAGTCAAAGCAGTTGTACTGATCACCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005181.3
Summary 'Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]'
Locus ID 761

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.