Adenosine Receptor A2a (ADORA2A) (NM_000675) Human 3' UTR Clone

CAT#: SC210862

3`UTR clone of adenosine A2a receptor (ADORA2A) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADORA2A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADORA2A
Synonyms A2aR; ADORA2; RDC8
ACCN NM_000675
Insert Size 873 bp
Sequence Data
>SC210862 3'UTR clone of NM_000675
The sequence shown below is from the reference sequence of NM_000675. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGATGGAGCAGGAGTGTCCTGATGATTCATGGAGTTTGCCCCTTCCTAAGGGAAGGAGATCTTTATCTT
TCTGGTTGGCTTGACCAGTCACGTTGGGAGAAGAGAGAGAGTGCCAGGAGACCCTGAGGGCAGCCGGTTC
CTACTTTGGACTGAGAGAAGGGAGCCCCAGGCTGGAGCAGCATGAGGCCCAGCAAGAAGGGCTTGGGTTC
TGAGGAAGCAGATGTTTCATGCTGTGAGGCCTTGCACCAGGTGGGGGCCACAGCACCAGCAGCATCTTTG
CTGGGCAGGGCCCAGCCCTCCACTGCAGAAGCATCTGGAAGCACCACCTTGTCTCCACAGAGCAGCTTGG
GCACAGCAGACTGGCCTGGCCCTGAGACTGGGGAGTGGCTCCAACAGCCTCCTGCCACCCACACACCACT
CTCCCTAGACTCTCCTAGGGTTCAGGAGCTGCTGGGCCCAGAGGTGACATTTGACTTTTTTCCAGGAAAA
ATGTAAGTGTGAGGAAACCCTTTTTATTTTATTACCTTTCACTCTCTGGCTGCTGGGTCTGCCGTCGGTC
CTGCTGCTAACCTGGCACCAGAGCCTCTGCCCGGGGAGCCTCAGGCAGTCCTCTCCTGCTGTCACAGCTG
CCATCCACTTCTCAGTCCCAGGGCCATCTCTTGGAGTGACAAAGCTGGGATCAAGGACAGGGAGTTGTAA
CAGAGCAGTGCCAGAGCATGGGCCCAGGTCCCAGGGGAGAGGTTGGGGCTGGCAGGCCACTGGCATGTGC
TGAGTAGCGCAGAGCTACCCAGTGAGAGGCCTTGTCTAACTGCCTTTCCTTCTAAAGGGAATGTTTTTTT
CTGAGATAAAATAAAAACGAGCCACATCGTGTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000675.4
Summary 'This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]'
Locus ID 135

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.