Angiotensin II Type 1 Receptor (AGTR1) (NM_032049) Human 3' UTR Clone

CAT#: SC210892

3`UTR clone of angiotensin II receptor type 1 (AGTR1) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AGTR1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AGTR1
Synonyms AG2S; AGTR1B; AT1; AT1AR; AT1B; AT1BR; AT1R; AT2R1; HAT1R
ACCN NM_032049
Insert Size 905 bp
Sequence Data
>SC210892 3'UTR clone of NM_032049
The sequence shown below is from the reference sequence of NM_032049. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGACATGTTCGAAACCTGTCCATAAAGTAAT
TTTGTGAAAGAAGGAGCAAGAGAACATTCCTCTGCAGCACTTCACTACCAAATGAGCATTAGCTACTTTT
CAGAATTGAAGGAGAAAATGCATTATGTGGACTGAACCGACTTTTCTAAAGCTCTGAACAAAAGCTTTTC
TTTCCTTTTGCAACAAGACAAAGCAAAGCCACATTTTGCATTAGACAGATGACGGCTGCTCGAAGAACAA
TGTCAGAAACTCGATGAATGTGTTGATTTGAGAAATTTTACTGACAGAAATGCAATCTCCCTAGCCTGCT
TTTGTCCTGTTATTTTTTATTTCCACATAAAGGTATTTAGAATATATTAAATCGTTAGAGGAGCAACAGG
AGATGAGAGTTCCAGATTGTTCTGTCCAGTTTCCAAAGGGCAGTAAAGTTTTCGTGCCGGTTTTCAGCTA
TTAGCAACTGTGCTACACTTGCACCTGGTACTGCACATTTTGTACAAAGATATGCTAAGCAGTAGTCGTC
AAGTTGCAGATCTTTTTGTGAAATTCAACCTGTGTCTTATAGGTTTACACTGCCAAAACAATGCCCGTAA
GATGGCTTATTTGTATAATGGTGTTACTAAAGTCACATATAAAAGTTAAACTACTTGTAAAGGTGCTGCA
CTGGTCCCAAGTAGTAGTGTCTTCCTAGTATATTAGTTTGATTTAATATCTGAGAAGTGTATATAGTTTG
TGGTAAAAAGATTATATATCATAAAGTATGCCTTCCTGTTTAAAAAAAGTATATATTCTACACATATATG
TATATGTATATCTATATCTCTAAACTGCTGTTAATTGATTAAAATCTGGCAAAGTTATATTTACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_032049.2
Summary 'Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2020]'
Locus ID 185

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.