TTF1 (NKX2-1) (NM_001079668) Human 3' UTR Clone

CAT#: SC210900

3`UTR clone of NK2 homeobox 1 (NKX2-1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NKX2-1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NKX2-1
Synonyms BCH; BHC; NK-2; NKX2.1; NKX2A; NMTC1; T/EBP; TEBP; TITF1; TTF-1; TTF1
ACCN NM_001079668
Insert Size 893 bp
Sequence Data
>SC210900 3'UTR clone of NM_001079668
The sequence shown below is from the reference sequence of NM_001079668. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGTCCTGCTCCACCTTGCTATACGGTCGGACCTGGTGAGAGGACGCCGGGCCGGCCCTAGCCCAGCGCT
CTGCCTCACCGCTTCCCTCCTGCCCGCCACACAGACCACCATCCACCGCTGCTCCACGCGCTTCGACTTT
TCTTAACAACCTGGCCGCGTTTAGACCAAGGAACAAAAAAACCACAAAGGCCAAACTGCTGGACGTCTTT
CTTTTTTTCCCCCCCTAAAATTTGTGGGTTTTTTTTTTTAAAAAAAGAAAATGAAAAACAACCAAGCGCA
TCCAATCTCAAGGAATCTTTAAGCAGAGAAGGGCATAAAACAGCTTTGGGGTGTCTTTTTTTGGTGATTC
AAATGGGTTTTCCACGCTAGGGCGGGGCACAGATTGGAGAGGGCTCTGTGCTGACATGGCTCTGGACTCT
AAAGACCAAACTTCACTCTGGGCACACTCTGCCAGCAAAGAGGACTCGCTTGTAAATACCAGGATTTTTT
TTTTTTTTTGAAGGGAGGACGGGAGCTGGGGAGAGGAAAGAGTCTTCAACATAACCCACTTGTCACTGAC
ACAAAGGAAGTGCCCCCTCCCCGGCACCCTCTGGCCGCCTAGGCTCAGCGGCGACCGCCCTCCGCGAAAA
TAGTTTGTTTAATGTGAACTTGTAGCTGTAAAACGCTGTCAAAAGTTGGACTAAATGCCTAGTTTTTAGT
AATCTGTACATTTTGTTGTAAAAAGAAAAACCACTCCCAGTCCCCAGCCCTTCACATTTTTTATGGGCAT
TGACAAATCTGTGTATATTATTTGGCAGTTTGGTATTTGCGGCGTCAGTCTTTTTCTGTTGTAACTTATG
TAGATATTTGGCTTAAATATAGTTCCTAAGAAGCTTCTAATAAATTATACAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001079668.2
Summary 'This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014]'
Locus ID 7080

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.