Plasminogen (PLG) (NM_000301) Human 3' UTR Clone

CAT#: SC211641

3`UTR clone of plasminogen (PLG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLG
• ACCN: NM_000301
• Insert Size: 1018 bp
• Sequence Data:
  Insert Sequence

  >SC211641 3'UTR clone of NM_000301
  The sequence shown below is from the reference sequence of NM_000301. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGATTGAGGGAGTGATGAGAAATAATTAATTGGACGGGAGACAGAGTGACGCACTGACTCACCTAGAGG
  CTGGAACGTGGGTAGGGATTTAGCATGCTGGAAATAACTGGCAGTAATCAAACGAAGACACTGTCCCCAG
  CTACCAGCTACGCCAAACCTCGGCATTTTTTGTGTTATTTTCTGACTGCTGGATTCTGTAGTAAGGTGAC
  ATAGCTATGACATTTGTTAAAAATAAACTCTGTACTTAACTTTGATTTGAGTAAATTTTGGTTTTGGTCT
  TCAACATTTTCATGCTCTTTGTTCACCCCACCAATTTTTAAATGGGCAGATGGGGGGATTTAGCTGCTTT
  TGATAAGGAACAGCTGCACAAAGGACTGAGCAGGCTGCAAGGTCACAGAGGGGAGAGCCAAGAAGTTGTC
  CACGCATTTACCTCATCAGCTAACGAGGGCTTGACATGCATTTTTACTGTCTTTATTCCTGACACTGAGA
  TGAATGTTTTCAAAGCTGCAACATGTATGGGGAGTCATGCAAACCGATTCTGTTATTGGGAATGAAATCT
  GTCACCGACTGCTTGACTTGAGCCCAGGGGACACGGAGCAGAGAGCTGTATATGATGGAGTGAACCGGTC
  CATGGATGTGTAACACAAGACCAACTGAGAGTCTGAATGTTATTCTGGGGCACACGTGAGTCTAGGATTG
  GTGCCAAGAGCATGTAAATGAACAACAAGCAAATATTGAAGGTGGACCACTTATTTCCCATTGCTAATTG
  CCTGCCCGGTTTTGAAACAGTCTGCAGTACACACGGTCACAGGAGAATGACCTGTGGGAGAGATACATGT
  TTAGAAGGAAGAGAAAGGACAAAGGCACACGTTTTACCATTTAAAATATTGTTACCAAACAAAAATATCC
  ATTCAAAATACAATTTAACAATGCAACAGTCATCTTACAGCAGAGAAATGCAGAGAAAAGCAAAACTGCA
  AGTGACTGTGAATAAAGGGTGAATGTAGTCTCAAATCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000301.3
• Summary: 'The plasminogen protein encoded by this gene is a serine protease that circulates in blood plasma as an inactive zymogen and is converted to the active protease, plasmin, by several plasminogen activators such as tissue plasminogen activator (tPA), urokinase plasminogen activator (uPA), kallikrein, and factor XII (Hageman factor). The conversion of plasminogen to plasmin involves the cleavage of the peptide bond between Arg-561 and Val-562. Plasmin cleavage also releases the angiostatin protein which inhibits angiogenesis. Plasmin degrades many blood plasma proteins, including fibrin-containing blood clots. As a serine protease, plasmin cleaves many products in addition to fibrin such as fibronectin, thrombospondin, laminin, and von Willebrand factor. Plasmin is inactivated by proteins such as alpha-2-macroglobulin and alpha-2-antiplasmin in addition to inhibitors of the various plasminogen activators. Plasminogen also interacts with plasminogen receptors which results in the retention of plasmin on cell surfaces and in plasmin-induced cell signaling. The localization of plasminogen on cell surfaces plays a role in the degradation of extracellular matrices, cell migration, inflamation, wound healing, oncogenesis, metastasis, myogenesis, muscle regeneration, neurite outgrowth, and fibrinolysis. This protein may also play a role in acute respiratory distress syndrome (ARDS) which, in part, is caused by enhanced clot formation and the suppression of fibrinolysis. Compared to other mammals, the cluster of plasminogen-like genes to which this gene belongs has been rearranged in catarrhine primates. [provided by RefSeq, May 2020]'
• Locus ID: 5340