AKT1 (NM_001014432) Human 3' UTR Clone

CAT#: SC211787

3`UTR clone of v-akt murine thymoma viral oncogene homolog 1 (AKT1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AKT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AKT1
Synonyms AKT; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA
ACCN NM_001014432
Insert Size 1003 bp
Sequence Data
>SC211787 3'UTR clone of NM_001014432
The sequence shown below is from the reference sequence of NM_001014432. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTGGAGG
GATGGAGAGGCGGCCTCGTGCCATGATCTGTATTTAATGGTTTTTATTTCTCGGGTGCATTTGAGAGAAG
CCACGCTGTCCTCTCGAGCCCAGATGGAAAGACGTTTTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGG
GGTAGGGAAGAAAACTATCCTGCGGGTTTTAATTTATTTCATCCAGTTTGTTCTCCGGGTGTGGCCTCAG
CCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGG
GGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCA
GCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATG
GTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCT
CTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCA
GTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTT
TAATCTTTGTGACAGGAAAGCCCTCCCCCTTCCCCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGG
GAGCCTCCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCTTTTCGACGCTTAACCTTTCCGCTGTCG
CCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCACGCCTCCTGGCCAGACGC
TGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTATAATATAA
TATGGAACCTTCCCTCCAAATTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001014432.1
Summary 'This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Co'
Locus ID 207

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.