Heparan Sulfate Proteoglycan 2 (HSPG2) (NM_005529) Human 3' UTR Clone

CAT#: SC212278

3`UTR clone of heparan sulfate proteoglycan 2 (HSPG2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSPG2
• Synonyms: HSPG; PLC; PRCAN; SJA; SJS; SJS1
• ACCN: NM_005529
• Insert Size: 1097 bp
• Sequence Data:
  Insert Sequence

  >SC212278 3'UTR clone of NM_005529
  The sequence shown below is from the reference sequence of NM_005529. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCC
  CGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCT
  TTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCA
  CAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGG
  AACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAG
  CTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCT
  GGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCT
  TTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTT
  TTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTC
  CTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGG
  GAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACC
  GGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGAC
  AACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACG
  ACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGT
  GCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTC
  CTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005529.5
• Summary: 'This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]'
• Locus ID: 3339