Laminin (LAMC3) (NM_006059) Human 3' UTR Clone

CAT#: SC213675

3`UTR clone of laminin gamma 3 (LAMC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LAMC3
• Synonyms: OCCM
• ACCN: NM_006059
• Insert Size: 1275
• Sequence Data:
  Insert Sequence

  >SC213675 3'UTR clone of NM_006059
  The sequence shown below is from the reference sequence of NM_006059. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGAGAACTGTGCCAGCTGGCAGTGAGGGCTGCCCAGATCCCCGGCACACACTCCCCCACCTGCTGTTTA
  CATGACCCAGGGGGTGCACACTACCCCACAGGTGTGCCCATACAGACATTCCCCGGAGCCGGCTGCTGTG
  AACTCGCCCCCGTGTGGATAGTCACTCCCTGCCGATTCTGTCTGTGGCTTCTTCCCTGCCAGCAGGACTG
  AGTGTGCGTACCCAGTTCACCTGGACATGAGTGCACACTCTCACCCCTGCACATGCATAAACGGGCACAC
  CCCAGTGTCAATAACATACACACGTGAGGGTGCATGTCTGTGTGTATGACCCACACGTGTTCAAGTCTAA
  TCCATCCAGTCAGCAGCTTACGGTCCACACACATTACAGTCCACAGCTGTTGTGAGAGCCACCTGTGTGC
  TGGACACCCTCTGGATGTTGGGCAAGTTGTTACATGAGATGCCCTGGGGTGCTACATCCACTCACTCCAG
  ATAGCAGGGAGGTCTCAGCAGATCTGCAGAGATCAAGGGGGTCAGCAACAGCCAAAGCCCCTAGTCCCAG
  AGCTGGCTGCCCTCTGTTTCACAGCAGCTCCCTGACCTGTGTTGCTGCGTGCACTCCCTACAGCTCGACA
  CAGCCAGGGGACCAACAGGCCAAGAAATGCAAGATCCCGGGAGGGTTCTTAGCAGCAGAATCTGAGGCCC
  AGAGACCCTGAGGCCGTGGCCAGGCCTGCTAGTCTGGCTAGAGCAAGGCCCATTCCTGGCGGGGGTGTCA
  TTGCCTTCACCGGACGCTTCCCTCTCAGGGTCCTGGGACTGCACCAGATGCCCTGAGGGAATGGCCCACC
  CTGGCCTGTACCCACTTCAGCCTGTGATCTATCCAAAGAGCCAGGCCCAAAAGCGCCTAGGTCAGGGTGC
  TCAGGCTACCAGGAGCACGCCTCTGTGCCCCCGGCAACCCAGTTGACCTTTAATTGACGCTTTCCAGACC
  AGCCCTGCGGCACCACTTGCCATGCGGGAGGCCACCAGGGTGTGCAAGCCTGGCTGCCATTCCAGTCTGT
  CCTGTCTGGGAATCGCCCTGTGGCCAGGCCCGCATGCTGGCCTCTGCCCAGGACTCCTCAGCATTTCCTC
  TTGGCATCCCTCCCCTCTCCCAGACCCTCTTCCAGCAGATGGCAAGGCCTCGGCATTGGGAAGTCAGGCA
  CCTCTGCGGGCCCAGCCCCCTCCCGTGGCTCCCCTGACAGGGGCAGGGGTAGGGCAGCAGCACAGACCAA
  TTCCGTTGAACGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006059.3
• Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
• Locus ID: 10319