Pigx (NM_024464) Mouse Untagged Clone

CAT#: MC200047

Pigx (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1, (10ug)


  "NM_024464" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Pigx"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pigx
Synonyms 2010319C14Rik; PIG-X
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002202 sequence for NM_024464
GTTCATACCTGCAGTTTTTTTAACACTTGGAAGTAAGAGGCGGGAGAATTGCAGGTTAAAGGCCAACCTG AGCTGCAGAGTAAATTTTAATCCAGCCTTAGCTAACCGGCAGTGATGCTATCAGAAAGTTTTAATATAGA AGCCCCCAACTACTTGTCCAATGAATCTGCAGTCCTCATTTATGCCCGGCAGGATGCACAGTGCATCGAC TGCTTCCAGGCCTTTTTACCTGTGCACTATCGCTATCACCGGCCACATAAGAAAGATGGAGACACCCTCA TTGTGGTCAACAACCCCGACTTACTGATGTACTGTGACCAAGAGTTTCCAATTTTGAAATGCTGGGCTCA GTCAGAAGTAGCAGCTCCTTGTGCTTTGAAGAGTGAGGAGATCTGCCAGTGGAAAAGCATGCAGTACAAA TCAATACTTAAGAATTTGACAGTGCAGGTTCCAGTGGGACTGACTATACATACCTCTTTAGTGTGTTCTG TGACGCTGCTCATTACGATTCTGTGTTCTACTTTGATCCTTTTAGCTGTTTTCAAATATGGCCACTTTTC CCTGTAAGTTTTGTACAGCTAAGTGTTTTCTATGAACCTAATAAATGAGACAAGAGTGCTCTTTTCAGAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_024464
ORF Size 453 bp
Insert Size 453
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC002202, AAH02202
RefSeq Size 644
RefSeq ORF 453
Locus ID 72084
Gene Summary This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.