Cdkn1a (NM_007669) Mouse Untagged Clone
CAT#: MC200171
Cdkn1a (untagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1, (10ug)
"NM_007669" in other vectors (5)
Product Images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Symbol | Cdkn1a |
| Synonyms | CAP20; CDKI; Cdkn1; CIP1; mda6; P21; p21Cip1; p21WAF; SDI1; Waf1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002043 sequence for NM_007669
TGGAGTCAGGCGCAGATCCACAGCGATATCCAGACATTCAGAGCCACAGGCACCATGTCCAATCCTGGTG ATGTCCGACCTGTTCCGCACAGGAGCAAAGTGTGCCGTTGTCTCTTCGGTCCCGTGGACAGTGAGCAGTT GCGCCGTGATTGCGATGCGCTCATGGCGGGCTGTCTCCAGGAGGCCCGAGAACGGTGGAACTTTGACTTC GTCACGGAGACGCCGCTGGAGGGCAACTTCGTCTGGGAGCGCGTTCGGAGCCTAGGGCTGCCCAAGGTCT ACCTGAGCCCTGGGTCCCGCAGCCGTGACGACCTGGGAGGGGACAAGAGGCCCAGTACTTCCTCTGCCCT GCTGCAGGGGCCAGCTCCGGAGGACCACGTGGCCTTGTCGCTGTCTTGCACTCTGGTGTCTGAGCGGCCT GAAGATTCCCCGGGTGGGCCCGGAACATCTCAGGGCCGAAAACGGAGGCAGACCAGCCTGACAGATTTCT ATCACTCCAAGCGCAGATTGGTCTTCTGCAAGAGAAAACCCTGAAGTGCCCACGGGAGCCCCGCCCTCTT CTGCTGTGGGTCAGGAGGCCTCTTCCCCATCTTCGGCCTTAGCCCTCACTCTGTGTGTCTTAATTATTAT TTGTGTTTTAATTTAAACGTCTCCTGTATATACGCTGCCTGCCCTCTCCCAGTCTCCAAACTTAAAGTTA TTTAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007669 |
| ORF Size | 480 bp |
| Insert Size | 480 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | BC002043, AAH02043 |
| RefSeq Size | 727 |
| RefSeq ORF | 480 |
| Locus ID | 12575 |
| Gene Summary | This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at the G1 pahse. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 both encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR227529 | Cdkn1a (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1 |
USD 68.00 |
|
| MG201211 | Cdkn1a (GFP-tagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a) |
USD 300.00 |
|
| MG227529 | Cdkn1a (GFP-tagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a) transcript variant 1, (10ug) |
USD 300.00 |
|
| MR227529L3 | Lenti ORF clone of Cdkn1a (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1 |
USD 500.00 |
|
| MR227529L4 | Lenti ORF clone of Cdkn1a (mGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China