Cdkn1a (NM_007669) Mouse Untagged Clone

CAT#: MC200171

Cdkn1a (untagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1, (10ug)


  "NM_007669" in other vectors (5)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cdkn1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cdkn1a
Synonyms CAP20; CDKI; Cdkn1; CIP1; mda6; P21; p21Cip1; p21WAF; SDI1; Waf1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002043 sequence for NM_007669
TGGAGTCAGGCGCAGATCCACAGCGATATCCAGACATTCAGAGCCACAGGCACCATGTCCAATCCTGGTG ATGTCCGACCTGTTCCGCACAGGAGCAAAGTGTGCCGTTGTCTCTTCGGTCCCGTGGACAGTGAGCAGTT GCGCCGTGATTGCGATGCGCTCATGGCGGGCTGTCTCCAGGAGGCCCGAGAACGGTGGAACTTTGACTTC GTCACGGAGACGCCGCTGGAGGGCAACTTCGTCTGGGAGCGCGTTCGGAGCCTAGGGCTGCCCAAGGTCT ACCTGAGCCCTGGGTCCCGCAGCCGTGACGACCTGGGAGGGGACAAGAGGCCCAGTACTTCCTCTGCCCT GCTGCAGGGGCCAGCTCCGGAGGACCACGTGGCCTTGTCGCTGTCTTGCACTCTGGTGTCTGAGCGGCCT GAAGATTCCCCGGGTGGGCCCGGAACATCTCAGGGCCGAAAACGGAGGCAGACCAGCCTGACAGATTTCT ATCACTCCAAGCGCAGATTGGTCTTCTGCAAGAGAAAACCCTGAAGTGCCCACGGGAGCCCCGCCCTCTT CTGCTGTGGGTCAGGAGGCCTCTTCCCCATCTTCGGCCTTAGCCCTCACTCTGTGTGTCTTAATTATTAT TTGTGTTTTAATTTAAACGTCTCCTGTATATACGCTGCCTGCCCTCTCCCAGTCTCCAAACTTAAAGTTA TTTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007669
ORF Size 480 bp
Insert Size 480
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC002043, AAH02043
RefSeq Size 727
RefSeq ORF 480
Locus ID 12575
Gene Summary This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at the G1 pahse. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 both encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.