Cox6a2 (NM_009943) Mouse Untagged Clone
CAT#: MC201388
Cox6a2 (untagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein, (10ug)
"NM_009943" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cox6a2 |
Synonyms | CoxVIaH; VIaH |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028514 sequence for NM_009943
GAGACAGAGAAGGACAGTGCCATTCCTAGCCTCCCTTTGACAATGGCTCTGCCTCTAAAGGTCCTGAGCC GGAGCATGGCCAGCGCAGCCAAAGGAGACCATGGAGGGGCAGGAGCCAACACCTGGCGCCTCCTGACCTT TGTGCTGGCTCTTCCCGGCGTAGCCCACTGCTCCCTTAACTGCTGGATGCACGCTGGCCACCACGAGCGC CCAGAGTTCATCCCGTATCACCACCTCCGCATCCGAACCAAGCCCTTCGCCTGGGGGGACGGCAACCACA CGCTTTTCCACAATCCCCACGTCAATCCTTTGCCCACCGGTTATGAGCACCCTTGATGTCTCAGCAGACA CGCTCTGCCAGCAATCTTCAAATTGGCCTTCTGCACACCGGCTCTGAGAGCCCCTGAGGTTCCAGTGGAC AGTTCCAAGCTCAATAAAGGTGTGGAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_009943 |
ORF Size | 294 bp |
Insert Size | 294 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC028514, AAH28514 |
RefSeq Size | 480 |
RefSeq ORF | 294 |
Locus ID | 12862 |
Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200280 | Cox6a2 (Myc-DDK-tagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein |
USD 68.00 |
|
MG200280 | Cox6a2 (GFP-tagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2) |
USD 300.00 |
|
MR200280L3 | Lenti ORF clone of Cox6a2 (Myc-DDK-tagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein |
USD 500.00 |
|
MR200280L4 | Lenti ORF clone of Cox6a2 (mGFP-tagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review