Cox6a2 (NM_009943) Mouse Untagged Clone

CAT#: MC201388

Cox6a2 (untagged) - Mouse cytochrome c oxidase, subunit VI a, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_009943" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cox6a2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox6a2
Synonyms CoxVIaH; VIaH
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028514 sequence for NM_009943
GAGACAGAGAAGGACAGTGCCATTCCTAGCCTCCCTTTGACAATGGCTCTGCCTCTAAAGGTCCTGAGCC GGAGCATGGCCAGCGCAGCCAAAGGAGACCATGGAGGGGCAGGAGCCAACACCTGGCGCCTCCTGACCTT TGTGCTGGCTCTTCCCGGCGTAGCCCACTGCTCCCTTAACTGCTGGATGCACGCTGGCCACCACGAGCGC CCAGAGTTCATCCCGTATCACCACCTCCGCATCCGAACCAAGCCCTTCGCCTGGGGGGACGGCAACCACA CGCTTTTCCACAATCCCCACGTCAATCCTTTGCCCACCGGTTATGAGCACCCTTGATGTCTCAGCAGACA CGCTCTGCCAGCAATCTTCAAATTGGCCTTCTGCACACCGGCTCTGAGAGCCCCTGAGGTTCCAGTGGAC AGTTCCAAGCTCAATAAAGGTGTGGAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_009943
ORF Size 294 bp
Insert Size 294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028514, AAH28514
RefSeq Size 480
RefSeq ORF 294
Locus ID 12862
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.