Cd274 (NM_021893) Mouse Untagged Clone

CAT#: MC201908

PD-L1 / CD274 (untagged) - Mouse PD-L1 / CD274 antigen (PD-L1 / CD274), (10ug)


  "NM_021893" in other vectors (6)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cd274"

Specifications

Product Data
Type Mouse Untagged Clone
Symbol Cd274
Synonyms A530045L16Rik; B7h1; Pdcd1l1; Pdcd1lg1; Pdl1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC201908 representing NM_021893
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGATATTTGCTGGCATTATATTCACAGCCTGCTGTCACTTGCTACGGGCGTTTACTATCACGGCTC
CAAAGGACTTGTACGTGGTGGAGTATGGCAGCAACGTCACGATGGAGTGCAGATTCCCTGTAGAACGGGA
GCTGGACCTGCTTGCGTTAGTGGTGTACTGGGAAAAGGAAGATGAGCAAGTGATTCAGTTTGTGGCAGGA
GAGGAGGACCTTAAGCCTCAGCACAGCAACTTCAGGGGGAGAGCCTCGCTGCCAAAGGACCAGCTTTTGA
AGGGAAATGCTGCCCTTCAGATCACAGACGTCAAGCTGCAGGACGCAGGCGTTTACTGCTGCATAATCAG
CTACGGTGGTGCGGACTACAAGCGAATCACGCTGAAAGTCAATGCCCCATACCGCAAAATCAACCAGAGA
ATTTCCGTGGATCCAGCCACTTCTGAGCATGAACTAATATGTCAGGCCGAGGGTTATCCAGAAGCTGAGG
TAATCTGGACAAACAGTGACCACCAACCCGTGAGTGGGAAGAGAAGTGTCACCACTTCCCGGACAGAGGG
GATGCTTCTCAATGTGACCAGCAGTCTGAGGGTCAACGCCACAGCGAATGATGTTTTCTACTGTACGTTT
TGGAGATCACAGCCAGGGCAAAACCACACAGCGGAGCTGATCATCCCAGAACTGCCTGCAACACATCCTC
CACAGAACAGGACTCACTGGGTGCTTCTGGGATCCATCCTGTTGTTCCTCATTGTAGTGTCCACGGTCCT
CCTCTTCTTGAGAAAACAAGTGAGAATGCTAGATGTGGAGAAATGTGGCGTTGAAGATACAAGCTCAAAA
AACCGAAATGATACACAATTCGAGGAGACGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites RsrII-NotI     
ACCN NM_021893
ORF Size 873 bp
Insert Size 873
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC066841, AAH66841
RefSeq Size 3653
RefSeq ORF 873
Locus ID 60533
Gene Summary The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.