Mgp (NM_008597) Mouse Untagged Clone

CAT#: MC202781

Mgp (untagged) - Mouse matrix Gla protein (Mgp), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mgp
• Synonyms: Mglap
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC079478 sequence for NM_008597
  CTCCCCTCTGCTGCTGCTGCTGCTGCGCCAGACACAGAGGCAGACTCACAGGACACCCGAGACACCATGA AGAGCCTGCTCCCTCTGGCCATCCTGGCTGCGCTGGCCGTGGCAACCCTGTGCTACGAATCTCACGAAAG CATGGAGTCCTATGAAATCAGTCCCTTCATCAACAGGAGAAATGCCAACACCTTTATGTCCCCTCAGCAG AGGTGGCGAGCTAAAGCCCAAAAGAGAGTCCAGGAACGCAACAAGCCTGCCTACGAGATCAACAGAGAGG CCTGCGATGACTACAAGCTGTGTGAGCGCTACGCCATGGTCTACGGCTACAACGCTGCCTACAACCGCTA CTTCAGGCAGCGCCGAGGAGCCAGATATTAGCGCGAAGAAACAGTCATTTGGTTGTGGAGTTTCGTTTTA TATCTCCTGCAGTAGCATTACTGAAGTATACAGACACGCATGCGTTGCTTGCTCCTTACATGATCTCCTA GCTGGCTGGCCCACTCCTTCCTTCCGCGGGTTGAAAGTAATGAAAGAGCAGTATTAAGAAGTGTGTTTAT ATATAATAAAATTCTGGTTTGATACGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_008597
• ORF Size: 315 bp
• Insert Size: 315
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC079478, AAH79478
• RefSeq Size: 617
• RefSeq ORF: 315
• Locus ID: 17313
• Gene Summary: This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. This protein also inhibits angiogenesis. Mice lacking a functional copy of this gene exhibit impaired differentiation of endothelial cells, reduced stature, and calcification and rupture of the vasculature leading to premature death. [provided by RefSeq, Sep 2016]