Fam24a (NM_183272) Mouse Untagged Clone

CAT#: MC205057

Fam24a (untagged) - Mouse family with sequence similarity 24, member A (Fam24a), (10ug)


  "NM_183272" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Fam24a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fam24a
Synonyms 1700063I17Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC048642
GGGGCTGTGACATTCTGGCAGCCCTGGCAGCCCTCAGACCTCCAACAGAGAGGTACATCAGCCTGCATCT TAAGTGACCTAACAGGTGTGAAAGATGTTCGACTTGAGGACGAAGGTTATGATCGGCATCGCTAGCACTC TGCTGATTGCTGCAATCATGCTGATAACGCTTGTGTTCTGTCTTTACCAGAAAATATCCAAGGCCCTGAA ACTCGCAAAGGAGCCTGAATGCTGTATTGATCCATGCAAGGACCCCAATGAGAAGATCATCCGGGCCAAG CCCATTATTGCTGAGACTTGTCGTAACCTCCCGTGTTGTGACGACTGTAGCATCTATAAGGATGTTGGCT CCCTGCCACCTTGCTATTGTGTCACAAATGAGGGACTCTGACATGGCAATGGTGGACACAAAAATCTTCA CAAACAGCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_183272
ORF Size 297 bp
Insert Size 297
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC048642, AAH48642
RefSeq Size 459
RefSeq ORF 297
Locus ID 68223

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.